Từ khoá: Số Hiệu, Tiêu đề hoặc Nội dung ngắn gọn của Văn Bản...

Đăng nhập

Quên mật khẩu?   Đăng ký mới
Đăng nhập bằng Google

Số hiệu: TCVN8400-26:2014 Loại văn bản: Tiêu chuẩn Việt Nam
Nơi ban hành: *** Người ký: ***
Ngày ban hành: Năm 2014 Ngày hiệu lực:
Tình trạng: Đã biết

Penicillin

1.000.000 IU

Streptomycin

 g

Nystatin

500.000 IU

Nước cất

10 ml

Lắc đều cho tan, lọc vô trùng bằng màng lọc có kích thước lỗ lọc 0,45 μm.

Sử dụng tốt nhất trong 1 tuần, bảo quản ở +4 °C.

A.2. Dung dịch muối đệm phosphat (PBS) 10x, pH ~ 7,2, sản phẩm thương mại

Dung dịch muối đệm phosphat 10x

100 ml

Nước cất (vô trùng)

900 ml

A.3. Dung dịch muối đệm photphat (PBS) pH ~ 7,2

Natri clorua (NaCl)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Natri hydro photphat dihydrat (Na2HPO4.2H2O)

2,9 g

Kali dihydro photphat (KH2PO4)

0,2 g

Kali clorua (KCl)

0,2 g

Nước cất

1000 ml

Chỉnh pH bằng dung dịch NaOH 1 N (xem 3.2) hoặc dung dịch HCl 1 N (xem 3.1). Hấp vô trùng ở 121 °C trong 30 min.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

A.4. Dung dịch hồng cầu gà 1%

Hồng cầu gà đặc

1 ml

Dung dịch PBS pH ~ 7,2

99 ml

Lắc đều, sử dụng trong 1 đến 2 ngày. Bảo quản ở nhiệt độ từ 4 °C đến 8 °C.

A.5. Dung dịch RDE - Xử lý RDE

A.5.1. Dung dịch RDE

RDE

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Nước muối sinh lý

20 ml

Lắc đều và chia nhỏ ra ống 3 ml và bảo quản trong tủ -20 °C.

A.5.2. Xử lý mẫu với dung dịch RDE

Nhỏ 1 phần huyết thanh cần xét nghiệm vào 3 phần RDE, lắc đều và ủ trong nồi cách thủy ở 37 °C trong thời gian từ 18 h đến 20 h, sau đó chuyển sang ủ trong nồi cách thủy ở 56 °C trong thời gian từ 30 min đến 60 min. Kết thúc quá trình ủ, giữ ở 4 °C trong 30 min sau đó nhỏ thêm 6 phần dung dịch PBS pH ~7,2. Sau khi xử lý RDE, huyết thanh xét nghiệm đã được pha loãng 10 lần.

A.6. Môi trường nuôi tế bào

Môi trường EMEM

500 ml

Huyết thanh thai bê (FCS) 10%

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Kháng sinh (Penicillin/Streptomycin: 10000 UI/ml)

5 ml

Chất chống nấm (Fungizone: 250 μg/ml)

5 ml

* Sử dụng tốt nhất trong 2 tuần, bảo quản ở nhiệt độ từ 4 °C đến 8 °C

A.7. Môi trường phát triển tế bào

Môi trường EMEM

500 ml

Huyết thanh thai bê (FCS), 10 %

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Kháng sinh (Penicillin/Streptomycin: 10000 UI/ml)

5 ml

Chống nấm (Fungison: 250 μg/ml)

5 ml

TPCK trypsin

500 μl

* Sử dụng tốt nhất trong ngày, bảo quản ở nhiệt độ từ 4 °C đến 8 °C

A.8. Cấy chuyển và nuôi tế bào

Nguyên liệu: 1 chai nuôi tế bào (MDCK hoặc CEF) 75 cm2 đã phát triển 1 lớp đạt 100 % bề mặt nuôi

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Môi trường nuôi tế bào (xem A6 phụ lục A)

Trypsin có 0,05 % EDTA

PBS (xem A2 phụ lục A)

CHÚ Ý: Tất cả các môi trường phải được cân bằng ở 37 °C  trước khi sử dụng và vật tư dùng cho tế bào đều phải được hấp vô trùng trước khi sử dụng.

Tiến hành như sau:

Bước 1: Hút bỏ môi trường đang nuôi trong chai tế bào MDCK, CEF 1 lớp

Bước 2: Rửa bề mặt thảm tế bào bằng PBS 2 lần với 10 ml/chai 75 cm2, tráng qua và hút bỏ PBS:

Bước 3: Tách tế bào

- Cho 2 ml trypsin (có 0,05 % EDTA) vào chai tế bào 75 cm2, láng đều lên bề mặt tế bào sao cho bề mặt tế bào được phủ một lớp trypsin.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

CHÚ Ý: không để tế bào trong trypsin quá 15 min.

- Khi tế bào đã tách hết, bổ sung 5 ml môi trường nuôi tế bào (xem A6 phụ lục A) vào chai để vô hoạt trypsin, trộn đều, chuyển toàn bộ huyễn dịch tế bào sang ống ly tâm 15 ml.

Bước 4: Loại bỏ Trypsin

- Ly tâm huyễn dịch tế bào ở gia tốc 3000 g/min trong 5 min.

- Loại bỏ phần dung dịch ở trên, giữ cặn tế bào.

Bước 5: Cân bằng môi trường và đếm số tế bào

- Làm long cặn tế bào bằng cách búng nhẹ vào thân ống chứa cặn tế bào.

- Bổ sung 10 ml môi trường nuôi tế bào, sau đó dùng pipet hút lên hút xuống nhẹ nhàng cho đến khi các tế bào phân tán đều trong dịch môi trường.

- Đếm tế bào: Pha loãng tế bào 100 lần (10 μl tế bào trong 990 μl môi trường nuôi tế bào), đếm tế bào bằng buồng đếm trên kính hiển vi (xem 4.12), tính số tế bào trong 1 ml.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Ghi nhãn chai nuôi tế bào mới (tên dòng tế bào, ngày nuôi cấy, lần cấy chuyển)

- Chia huyễn dịch tế bào vào 1 chai 75 cm2 và 1 đĩa 12 giếng:

* Chai tế bào 75 cm2 khi nuôi cấy cần 6x106 tế bào/chai

* Đĩa tế bào 12 giếng khi nuôi cấy cần 1x106 tế bào/đĩa

Bước 7: Nuôi tế bào và kiểm tra sự phát triển:

- Chai tế bào 75 cm2 bổ sung 20 ml môi trường nuôi tế bào và 6 x 106 tế bào MDCK sau khi đếm.

- Đĩa tế bào 12 giếng: Ống ly tâm 50 ml có 18 ml môi trường nuôi tế bào và 1 x 106 tế bào MDCK, CEF sau khi đếm, trộn đều và chia nhỏ ra 12 giếng mỗi giếng 1,5 ml.

Bước 8: Nuôi chai tế bào và đĩa tế bào trong tủ ấm có 5 % CO2 duy trì ở 37 °C.

Theo dõi sự phát triển hàng ngày của tế bào trên kính hiển vi (xem 4.12)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Kháng nguyên cần được kiểm tra hiệu giá bằng phản ứng HA và pha ở hiệu giá 4HA/25 μl để dùng trong phản ứng HI. Ví dụ:

Hiệu giá kháng nguyên trong phản ứng HA là 1/256 thì 4 HA bằng 4 x 1/256 = 1/64

Pha 4 HA/25 μl gồm 1 phần kháng nguyên và 63 phần PBS pH ~ 7,2.

Hiệu chỉnh kháng nguyên 4 HA/25 μl bằng phản ứng HA (xem phụ lục B). Nếu kết quả ngưng kết đến giếng thứ 2, là kháng nguyên pha đạt. Nếu ngưng kết đến giếng thứ 3 (hoặc hơn) là kháng nguyên pha đặc, hiệu giá là 8 HA (hoặc hơn). Nếu ngưng kết chỉ ở giếng đầu tiên hoặc giếng thứ 1 là kháng nguyên pha loãng. Dựa vào kết quả đó để bổ sung thêm PBS pH ~ 7,2 hoặc kháng nguyên để có kháng nguyên là 4HA chuẩn.

A.10. Xử lý huyết thanh chống hiện tượng gây ngưng kết hồng cầu giả

Hiện tượng gây ngưng kết hồng cầu giả có thể xử lý bằng cách hấp phụ huyết thanh kiểm tra với hồng cầu gà. Thêm 25 μl hồng cầu đặc vào 500 μl huyết thanh, lắc nhẹ và để ở nhiệt độ phòng trong 30 min, sau đó ly tâm ở tốc độ 1500 đến 2500 g/min (xem 4.6) trong 2 min đến 5 min. Thu lấy huyết thanh đã hấp phụ để xét nghiệm.

 

Phụ lục B

(Quy định)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

B.1. Thuốc thử và vật liệu thử

Hồng cầu gà 1 % (xem A4 phụ lục A).

Dịch môi trường sau khi phân lập trên tế bào hoặc dung dịch niệu mô sau khi phân lập trên trứng

Kháng nguyên chuẩn cúm gia cầm H5N1

Dung dịch PBS pH ~ 7,2 (xem A3 phụ lục A).

B.2. Thiết bị, dụng cụ

Sử dụng các đĩa ngưng kết 96 giếng, đáy chữ V, pipet các loại, đầu típ các cỡ (xem 4.2).

B.3. Cách tiến hành (xem sơ đồ bên dưới)

Cho 25 μl PBS pH ~ 7,2 vào các giếng từ giếng 1 đến giếng 12. Cho 25 μl dịch môi trường sau khi phân lập trên tế bào, dung dịch niệu mô sau khi phân lập trên trứng hoặc kháng nguyên chuẩn vào giếng 1.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Cho 25 μl hồng cầu gà 1 % vào mỗi giếng, lắc nhẹ trên máy lắc trong 1 min. Để đĩa phản ứng ở nhiệt độ phòng và đọc kết quả sau 30 min.

B.4. Đọc kết quả

Định tính:

Phản ứng HA dương tính khi có hạt ngưng kết hồng cầu lấm chấm.

Phản ứng HA âm tính khi không có ngưng kết hồng cầu

Những mẫu dương tính với phản ứng HA là những mẫu có chứa vi rút gây ngưng kết hồng cầu (một đặc tính của vi rút cúm).

Định lượng:

Phản ứng HA dương tính khi có hạt ngưng kết lấm chấm ở độ pha loãng (hiệu giá) ≥ 1/4.

Phản ứng HA âm tính khi không có ngưng kết hồng cầu hoặc có ngưng kết nhưng ở độ pha loãng < 1/4

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Hiệu giá HA của một mẫu được xác định tại nồng độ pha loãng cao nhất có ngưng kết hồng cầu. Ví dụ mẫu có phản ứng HA dương tính ở độ pha loãng 1/1024 thì hiệu giá HA của mẫu được xác định là 1/1024 hoặc 10 log2.

Sơ đồ các bước tiến hành phản ứng ngưng kết hồng cầu gà (HA)

Các bước

Nguyên liệu

Giếng

1

2

3

4

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

6

7

8

9

10

11

12

Pha loãng KN

PBS, μl

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

25

25

25

25

25

25

25

25

25

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

25

KN kiểm tra, μl

25

Trộn đều, chuyển 25 μl lần lượt từ giếng 1 đến giếng 11 rồi hút bỏ 25 μl

0

Cho HC gà

HC gà 1 %, μl

25

25

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

25

25

25

25

25

25

25

25

25

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

 

CHÚ THÍCH: KN: kháng nguyên; HC: hồng cầu.

 

Phụ lục C

(Quy định)

Phản ứng ngăn trở ngưng kết hồng cầu gà (HI)

Cho 25 μl PBS pH ~ 7,2 vào các giếng từ giếng 1 đến giếng 12. Cho 25 μl huyết thanh cần kiểm tra vào giếng 1.

Trộn đều huyết thanh với PBS ở giếng 2, chuyển 25 μl sang giếng 3 và trộn đều, chuyển 25 μl sang giếng 4, tiếp tục đến giếng 11, hút bỏ 25 μl ở giếng 11.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Lắc nhẹ trên máy lắc sau đó để đĩa ở nhiệt độ phòng 30 min.

Cho 25 μl hồng cầu gà 1 % vào mỗi giếng, lắc nhẹ trong 1 min. Để đĩa phản ứng ở nhiệt độ phòng. Đọc kết quả sau 30 min (xem sơ đồ dưới đây).

Sơ đồ các bước tiến hành phản ứng ngăn trở ngưng kết hồng cầu gà (HI)

Các bước

Nguyên liệu

Giếng

1

2

3

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

5

6

7

8

9

10

11

12

Pha loãng huyết thanh

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

0

25

25

25

25

25

25

25

25

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

25

50

Huyết thanh kiểm tra

50

Chuyển 25 μl từ giếng 1 sang giếng 2, trộn đều, chuyển tiếp tục đến giếng 11 rồi hút bỏ 25 μl

0

Cho kháng nguyên

KN 4 HA μl

25

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

25

25

25

25

25

25

25

25

25

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Lắc nhẹ, để 30 min ở nhiệt độ phòng

Cho hồng cầu gà

Hồng cầu gà 1 %, μl

25

25

25

25

25

25

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

25

25

25

25

25

Độ pha loãng kháng thể

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

 

 

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

 

Phụ lục D

(Tham khảo)

Phương pháp chiết tách ARN

Dùng huyễn dịch đã xử lý (xem 5.2.2.1) để chiết tách ARN. Có thể sử dụng bộ kít Qiagen® Rneasy Extraction cat # 74104 50 prep hoặc # 74106 250 prep theo quy trình dưới đây:

Nhỏ 200μl dịch nghiền mô vào ống ly tâm loại 1,5ml cùng với 600μl Qiagen® buffer RLT có 1 % β-ME, lắc đều trên máy Vortex rồi ly tâm nhẹ.

Thêm 500 μl etanol 70 % (xem 3.3) vào ống, lắc mạnh bằng máy Vortex rồi ly tâm nhẹ.

Chuyển tất cả dịch ni sang cột lọc RNeasy® Qiagen, ly tâm trong 15 s với tốc độ 10.000 r/min ở nhiệt độ phòng.

Bổ sung 700 μl dung dịch rửa 1 (RW1 buffer) vào cột RNeasy® Qiagen, ly tâm trong 15 s ở 10.000 g/min, thay ống thu mới vào cột lọc.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Thay ống thu mới, ly tâm cột lọc và ống thu trong 2 min ở tốc độ 12.000 g/min trở lên, bỏ ống thu.

Đặt cột lọc vào ống thu ARN, nhỏ 50 μl nước sạch nuclease vào cột lọc, ủ ở nhiệt độ phòng trong ít nhất 1 min. Tách ARN bằng cách ly tâm trong 1 min ở tốc độ 10.000 g/min, bỏ cột lọc, giữ lại dung dịch trong ống thu ARN.

Bảo quản mẫu ARN thu được ở 4 °C  trong thời gian ngắn trước khi làm RT-PCR, nếu để sau 24 h, nên bảo quản mẫu ở - 20 °C hoặc nhiệt độ thấp hơn.

 

Phụ lục E

(Tham khảo)

Trình tự một số cặp mồi, hỗn hợp phản ứng và chu trình nhiệt sử dụng cho phản ứng rRT-PCR và RT-PCR để phát hiện vi rút cúm A H5N1

E.1. Trình tự mồi - mẫu dò, lượng hỗn hợp phản ứng và chu trình nhiệt cho phản ứng Realtime RT-PCR

Bảng E1: Trình tự mồi-mẫu dò phát hiện gen M, H5, N1 trong RRT-PCR

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Kí hiệu mồi/probe

Trình tự (5'-3')

M-4

(CDC)

 

Dùng tốt cho phát hiện vi rút cúm gia cầm độc lực cao

InfA Probe

FAM-TGCAGTCCTCGCTCACTGGGCACG-BHQ1

InfA xuôi

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

InfA ngược

AGGGCATTYTGGACAAAKCGTCTA

M

(AAHL)

 

Dùng tốt cho phát hiện vi rút cúm gia cầm độc lực thấp

IVA-MA-P

TET-TCAGGCCCCCTCAAAGCCGA-BHQ1

IVA-D161M-F

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

IVA-D162M-R

TGC AAA NAC ATC YTC AAG TCT CTG

H5-3S

(AAHL+

Probe HA 2-3)

 

Dùng tốt cho phát hiện vi rút cúm gia cầm H5 thuộc clade 2.3.4

Probe

HEX-TCA ACA GTG GCG AGT TCC CTA GCA-BHQ1

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

TET-TCAACAGTTGCGAGTTCTCTAGCA-BHQ1

Xuôi

ACGTATGACTACCCGCAGTATTCA

Ngược

AGACCAGCTACCATGATTGC

H5-3

(AAHL)

 

Dùng tốt cho phát hiện vi rút cúm gia cầm H5 thuộc clade 1

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

TET-CAACAGTG GCGAGTTCCCTAGCA-BHQ1

IVA-D148H5-F

AAA CAGAGAGGAAATAAGTGG AGTAAA ATT

IVA-D149H5-R

AAA GATAGACCAGCTACCATGATTGC

H5-A

(CDC)

 

Dùng tốt cho phát hiện vi rút cúm gia cầm H5 clade 2.3.2 a

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

TGACTACCC GCAGTATTCAGAAGAAGCAAGACTAA

AH5a Probe2 2*

CAACTATCCGCAGTATTCAGAAGAAGCAAGATTAA

AH5a xuôi

TGGAAAGTRTAARAAACGGAACGT

AH5a ngược

YGCTAGGGARCTCGCCACTG

H5-B

(CDC)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Dùng tốt cho phát hiện vi rút cúm gia cầm H5 clade 2.3.2 b

AH5b Probe2

TACCCA TACCAACCA“T”CT ACCATTCCCTGCCAT

AH5b xuôi

GGAATG YCCCAAATATGTGAAATCAA

AH5b ngược

CCACTCCCCTGCTCRTTGCT

N1-2

(China)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

FAM-TGGTCT TGGCCAGACGGTGC-BHQ1

Xuôi

TGGACTAGTGGGAGCAGCAT

Ngược

TGTCAATGGTTAAGGGCAACTC

Bảng E2: Hỗn hợp phản ứng được chuẩn bị trong ống 0,2 ml với các lượng cụ thể cho mỗi phản ứng

Hỗn hợp phản ứng

(Theo hướng dẫn của Kít Invitrogen Superscript 3 qRT-PCR Kit)

Lượng dùng cho 1 phản ứng, μl

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

12,5

Mồi xuôi 20 μM

0,5

Mồi ngược 20 μM

0,5

Taqman probe 6 μM

0,5

Enzyme mix

0,5

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

5,5

Mẫu ARN

5

Tổng

25

Bảng E3: Chu trình nhiệt cho phản ứng Realtime RT-PCR
phát hiện vi rút cúm gia cầm H5N1

Chu trình 1

Chu trình 2

50 °C trong 15 min

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

(95 °C trong 10 s

58 °C trong 50 s)

lặp lại 40 lần

E.2. Trình tự mồi, lượng hỗn hợp phản ứng và chu trình nhiệt cho phản ứng RT-PCR

Bảng E4: Trình tự các cặp mồi và mẫu dò phát hiện gen M vi rút cúm A và các gen H5, N1 dùng trong phản ứng RT-PCR

TT

Cặp mồi

Trình tự chuỗi

Kích thước
sản phẩm

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

H5-219f

GAG TGA AGC GTC TCA TTT TG

296

H5-515r

GAT CTT CTT GGT TGG TAT TAT GTA GCT CC

2

IVA-D150-H5f

GGA ATG CCC CAA ATA TGT GAA ATC

150

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

TCT ACC ATT CCC TGC CAT CC

3

AI N1-f6

AGC AGG AGA TTA AAA TGA ATC CAA

586

AI N1-595

CTG GAC CAG AAA TTC CGA TTG

4

NP1200f

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

329

NP 1529r

GCA TTG TCT CCG AAG AAA TAA G

5

M52F

CTT CTA ACC GAG GTC GAA ACG

201

M253R

AGG GCA TTT TGG ACA AAK CGT CTA

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

H5F 936

GCC ATT CCA CAA CAT ACA CCC

363

H5R 1299

TAA ATT CTC TAT CCT CCT TTC CAA

Bảng E5: Hỗn hợp phản ứng được chuẩn bị trong ống 0,2 ml với lượng cụ thể cho mỗi phản ứng như trong bảng dưới đây tùy theo loại kit sử dụng

Kít RT-PCR 1 bước của hãng Qiagen

Kít RT-PCR của hãng Invitrogen

H2O

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

H2O

6 μl

5X Buffer

5 μl

2X Reaction mix

12,5 μl

dNTP

1 μl

RT/plat Taq mix

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Enzyme mix

1 μl

Mồi xuôi 20 μM

0,5 μl

Mồi xuôi 20 μM

0,5 μl

Mồi ngược 20 μM

0,5 μl

Mồi ngược 20 μM

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Mẫu ARN

5 μl

Mẫu ARN

5 μl

-

-

Tổng cộng

25 μl

Tổng cộng

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

 

Bảng E6 - Chu trình nhân gen

Số chu kỳ

Nhiệt độ

Thời gian

1 chu kỳ

60 °C

1 min

42 °C

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

50 °C

30 min

95 °C

15 min

35 đến 40 chu kỳ

94 °C

30 s

50 °C

30 s

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

1 min

1 chu kỳ

72 °C

10 min

Chu trình nhân gen này áp dụng cho cặp mồi H5 (F 936 và R 1299) và N1 (F 6 và R 595), đối với các cặp mồi khác quy trình có thể cần được điều chỉnh cho phù hợp.

 

Phụ lục F

(Qui định)

Sơ đồ chẩn đoán bệnh cúm gia cầm

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Sơ đồ chẩn đoán bệnh cúm gia cầm

 

THƯ MỤC TÀI LIỆU THAM KHẢO

[1] O.I.E. (2012,). Avian Influenza Disease. In Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (Version adopted by the World Assembly of Delegates of the OIE in May 2012).

[2] Bộ Nông Nghiệp và Phát triển Nông thôn (2006). 10 TCN - Qui trình chẩn đoán bệnh cúm gia cầm.

Văn bản này chưa cập nhật nội dung Tiếng Anh

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Tiêu chuẩn quốc gia TCVN 8400-26:2014 về Bệnh động vật - Quy trình chẩn đoán - Phần 26: Bệnh cúm gia cầm H5N1

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


2.422

DMCA.com Protection Status
IP: 222.255.214.198