Từ khoá: Số Hiệu, Tiêu đề hoặc Nội dung ngắn gọn của Văn Bản...

Đăng nhập

Quên mật khẩu?   Đăng ký mới
Đăng nhập bằng Google

Số hiệu: TCVN8400-21:2014 Loại văn bản: Tiêu chuẩn Việt Nam
Nơi ban hành: *** Người ký: ***
Ngày ban hành: Năm 2014 Ngày hiệu lực:
Tình trạng: Đã biết

Tên

Cặp mồi/ Mẫu dò

Trình tự gen (5’-3’)

Đầu gắn huỳnh quang

5’

3’

PRRS-1 (NA)

Mẫu dò

TGT GGT GAA TGG CAC TGA TTG ACA

FAM

BHQ1

Mồi xuôi

ATG ATG RGC TGG CAT TCT

Không

Không

Mồi ngược

ACA CGG TCG CCC TAA TTG

Không

Không

PRRS-2 (EU)

Mẫu dò

CCT CTG CTT GCA ATC GAT CCA GAC

FAM

BHQ1

Mồi xuôi

GCA CCA CCT CAC CCA GAC

Không

Không

Mồi ngược

CAG TTC CTG CGC CTT GAT

Không

Không

PRRS- China (JVM)

Mẫu dò

CGCGTAGAACTGTGACAACAACGCTGA

HEX

BHQ1

Mồi xuôi

CCCAAGCTGATGACACCTTTG

Không

Không

Mồi ngược

AATCCAGAGGCTCATCCTGGT

Không

Không

CHÚ THÍCH:

PRRS-1 (NA) dùng để phát hiện vi rút PRRS chủng Bắc Mỹ

PRRS-2 (EU) dùng để phát hiện vi rút PRRS chủng châu Âu

PRRS-China (JVM) dùng đ phát hiện vi rút PRRS độc lực cao (Trung Quốc) gây bệnh ở Việt Nam

5.2.2.2.2. Cách tiến hành:

- Mẫu bệnh phẩm sau khi xử lý (xem 5.2.2.1), được chiết tách ARN (xem phụ lục B) bằng kít chiết tách để làm khuôn mẫu cho phản ứng rRT-PCR.

- Phản ứng rRT-PCR (xem phụ lục B) có thể khác nhau tùy thuộc vào loại kít nhân gen s dụng.

5.2.2.2.3. Đánh giá kết quả

Kết quả chạy rRT - PCR được xác định dựa vào chu kỳ ngưỡng (Ct) phát hiện tín hiệu huỳnh quang.

- Mẫu được coi là dương tính khi có Ct ≤ 35.

- Mẫu được coi là âm tính nếu không có Ct.

- Mu được coi là nghi ngờ nếu Ct >35, trường hợp này phải xét nghiệm lại hoặc dùng phương pháp khác (phân lập vi rút) để khẳng định.

5.2.2.3. Phương pháp phân lập vi rút trên tế bào

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Kiểm tra tế bào hàng ngày bằng kính hiển vi soi ngược (xem 4.9). Nếu có vi rút PRRS, vi rút sẽ gây nên những biến đổi bệnh tích tế bào (CPE) với đặc điểm các tế bào co tròn, thảm tế bào bong tróc khỏi bề mặt dụng cụ nuôi cấy. CPE thường xuất hiện sau 4 ngày đến 7 ngày gây nhiễm.

- Sau 7 ngày thu lấy hết huyễn dịch tế bào vào ống ly tâm 50 ml (xem 4.14), cất ở tủ lạnh âm sâu (xem 4.1), sau đó lấy ra rã đông, ly tâm bằng máy ly tâm (xem 4.6) ở gia tốc 3000 g trong 10 min. Thu dịch nước trong cho giám định vi rút hoặc cấy chuyển lần thứ hai.

5.2.2.4. Phương pháp giám định vi rút

Giám định vi rút bằng phương pháp rRT- PCR (5.2.2.2).

5.2.3. Phát hiện kháng thể

Phản ứng huyết thanh học có ý nghĩa chẩn đoán khi lợn mắc bệnh có triệu chứng, bệnh tích nghi PRRS và chưa tiêm phòng vắc xin PRRS, hoặc s dụng để đánh giá kết quả tiêm phòng vắc xin PRRS.

5.2.3.1. X lý bệnh phẩm

Bệnh phẩm là huyết thanh (xem 5.2.1.2): lắc bng máy lắc trộn (xem 4.7), rồi ly tâm nhanh bằng máy ly tâm (xem 4.5) ở gia tốc 8000 g trong 1 min. Sau đó xử lý ở nhiệt độ 56 °C trong 30 min để diệt bổ thể rồi đem tiến hành các phương pháp để phát hiện kháng thể.

5.2.3.2. Phương pháp ELISA (Enzyme linked immonosorbent assay)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

5.2.3.3. Phương pháp IPMA (Immunoperoxidase monolayer assay)

5.2.3.3.1. Nguyên tắc

Đây là phương pháp sử dụng một thảm tế bào đã gây nhiễm vi rút chuẩn để phát hiện kháng thể. Nếu huyết thanh có kháng thể thì có sự kết hợp của kháng nguyên, kháng thể và kháng kháng thể, khi cho cơ chất vào sẽ xuất hiện màu đỏ đậm, đó là phản ứng dương tính. Phản ứng âm tính nếu thảm tế bào có màu hồng nhạt.

5.2.3.3.2. Chuẩn bị

- Môi trường phát triển tế bào MEM có 5 % FCS (huyết thanh thai bê) (xem phụ lục A).

- Dung dịch A: dung dịch cố định tế bào, gồm: PBS có 10 % formalin (xem 3.4) và 1 % NP40 (xem 3.6).

- Dung dịch B: dung dịch nước rửa, gồm PBS (xem phụ lục A) với 1 % Tween 80.

- Dung dịch C: dung dch pha loãng mẫu, gồm PBS (xem phụ lục A) với 1 % Tween 80 và 5 % sữa gây (xem 3.5).

- Dung dịch E: dung dịch AEC (3 - Amino - 9 - ethylcarbazole), gồm 1 ml dung dịch AEC (xem 3.8) nguyên chất + 14 ml dung dịch đệm axetat 0,1 M (pH 5,2) + 15 μl H2O2 30 % (xem 3.7).

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Giống vi rút chuẩn PRRS.

5.2.3.3.3. Cách tiến hành

a) Bước 1: Chuẩn bị tế bào MARC -145 (hoặc tế bào PAM) trên đĩa nuôi tế bào 96 giếng

- Tế bào MARC-145 (hoặc tế bào PAM) (xem phụ lục C) đựng trong ống cryo được đưa ra khỏi bình nitơ lỏng, nhanh chóng giải đông rồi cho hỗn hợp tế bào vào ống ly tâm 15 ml (xem 4.14) có chứa sẵn 10 ml môi trường phát triển tế bào MEM có 5 % FCS. Trộn đều bằng pipet 5000 ml (xem 4.15), cho vào ly tâm ở gia tốc 1500 g trong 5 min. Hút bỏ nước trong ở trên, giữ phần cặn ở dưới rồi cho tiếp vào 5ml môi trưng phát triển tế bào MEM có 5 % FCS, trộn đều bằng pipet. Hút chuyển dung dịch này vào chai nuôi tế bào 25 cm2. Đem giữ trong t ấm (xem 4.3), sau 24 h đưa ra quan sát dưới kính hiển vi (xem 4.9), xem sự phát triển của tế bào. Thay môi trường phát triển tế bào 1 lần/ngày. Sau từ 2 ngày đến 4 ngày sẽ thu đưc một thảm tế bào. Thu tế bào khi đã phát triển trên 90 % diện tích chai nuôi cấy.

- Thu hoạch tế bào MARC-145 (hoặc tế bào PAM) rồi tiến hành pha loãng tế bào với môi trưng phát triển tế bào MEM có 5 % FCS với số lượng cần thiết (5 x 104 tế bào/ml), chia đều vào đĩa nuôi tế bào 96 giếng với lượng 100 μl/giếng bằng pipet đa kênh (xem 4.16).

- đĩa tế bào trong t ấm (xem 4.3) và nuôi từ 1 ngày đến 2 ngày cho đến khi tế bào trong các giếng phát triển thành một lớp ở đáy giếng.

b) Bước 2: Gây nhiễm tế bào với vi rút PRRS

- Lấy giống vi rút chuẩn từ nơi bảo qun, làm tan đá nhanh rồi pha loãng với môi trưng phát triển tế bào MEM có 5 % FCS để được liều 500 TCID50 vi rút/ml (giống vi rút đã được hiệu chỉnh nồng độ trước). Xem phụ lục E về cách tính liều TCID50.

- Cho 100 μl dung dịch vi rút đã pha loãng ở trên vào mỗi giếng.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

c) Bước 3: Cố định tế bào đã nhiễm vi rút

- Đổ bỏ dung dịch có trong tất cả các giếng của đĩa.

- Cho 100 μl dung dịch A vào mỗi giếng.

- ở nhiệt độ phòng khoảng 30 min.

- Đổ bỏ dung dịch A, ri rửa đĩa 2 lần bằng dung dịch rửa B với lượng 300 μl/giếng.

d) Bước 4: Cho huyết thanh cần kiểm tra

- Đối với phản ứng định tính kháng thể thì chỉ pha loãng huyết thanh ở mức 1/160.

- Đối với phản ứng định lượng kháng thể pha loãng huyết thanh gấp 4 lần bắt đầu từ 1/10 đến 1/2560.

- Cho 50 μl huyết thanh cần kiểm tra đã pha loãng vào các giếng tương ứng.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Đổ bỏ dung dịch trong đĩa, rồi rửa đĩa 3 lần bằng dung dịch B với lượng 300 μl/giếng.

e) Bước 5: Cho kháng kháng thể PRRS có gắn enzyme (conjugate + peroxidase) (kháng thể này được chế trên thỏ)

- Pha loãng kháng kháng thể với dung dịch pha loãng (dung dịch nước rửa B) theo tỷ lệ 1/600.

- Cho 50 μl kháng kháng thể đã pha loãng này vào mỗi giếng.

- đĩa ở 37 °C trong 30 min.

- Đổ b dung dịch trong đĩa, rồi rửa đĩa 3 lần bằng dung dịch rửa B với lượng 300 μl/giếng.

f) Bước 6: Cho cơ chất

- Cho vào mỗi giếng 50 μl dung dịch AEC - dung dịch E.

- đĩa ở nhiệt độ phòng 30 min.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Để đọc kết quả, sử dụng kính hiển vi soi ngược (xem 4.9) để quan sát:

- Nếu quan sát thấy thảm tế bào trong giếng có những đám tế bào bắt màu đỏ đậm thì mẫu huyết thanh cho vào giếng đó dương tính kháng thể PRRS,

- Nếu quan sát thảm tế bào trong giếng thấy toàn bộ thảm tế bào có màu hồng nhạt - màu của môi trường phát triển tế bào thì mẫu huyết thanh cho vào giếng đó âm tính kháng thể PRRS.

6. Báo cáo kết quả

Lợn được kết luận mắc bệnh PRRS khi có các đặc điểm về triệu chứng, bệnh tích điển hình và có kết quả xét nghiệm dương tính với vi rút PRRS hoặc dương tính kháng thể PRRS bằng các phương pháp trong tiêu chuẩn này.

 

PHỤ LỤC A

(Quy định)

Thành phần và chuẩn bị môi trường và dung dịch thuốc thử

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

A.1.1. Thành phn

Penicillin

1 000 000 UI

 

Mycostatin

250 000 UI

 

Streptomycin

200 mg

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Kanamycin

1 000 000 UI

 

Nước cất vô trùng

100 ml

 

A.1.2. Chuẩn bị

Hòa tan kháng sinh với nước cất trong chai thủy tinh vô trùng 100 ml (xem 4.13) rồi lọc bằng màng lọc (xem 4.20). Bảo quản ở ngăn đá t lạnh thường (xem 4.2).

A.2. Dung dịch PBS 0,01 M, pH 7,2

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Natri clorua (NaCl)

8g

 

Kali clorua (KCl)

0,2 g

 

Dinatri hidrophosphat (Na2HPO4)

1,15 g

 

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

0,2 g

 

c cất vô trùng

1 000 ml

 

A.2.2. Chuẩn bị

Hòa tan các thành phần với nước cất trong chai thủy tinh vô trùng (xem 4.13), chỉnh pH đến 7,2 bằng dung dịch NaOH 1 N hoặc dung dịch HCl 1 N. Hấp tiệt trùng bằng nồi hấp (xem 4.12) ở nhiệt độ 121 °C trong 15 min, bảo quản ở 4 °C của t lạnh thường (xem 4.2).

A.3. Dung dịch NaHCO3 7 %

A.3.1. Thành phn

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

7 g

 

Nước cất vô trùng

100 ml

 

A.3.2. Chuẩn bị

Hòa tan NaHCO3 với nước cất trong chai thủy tinh vô trùng (xem 4.13), hấp tiệt trùng bằng nồi hấp (xem 4.12) ở nhiệt độ 121°C trong 15 min và bảo quản ở 4 °C của tủ lạnh thường (xem 4.2).

A.4. Dung dịch L-glutamin 3 %

A.4.1. Thành phn

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

3 g

 

Nước cất vô trùng

100 ml

 

A.4.2. Chuẩn bị

Hòa tan L-glutamin với nước cất trong chai thủy tinh vô trùng (xem 4.13), lọc vô trùng bằng màng lọc (xem 4.20), sau đó chia ra các ống ly tâm 15 ml (xem 4.14) vô trùng với lượng 10 ml/ống và bảo quản ở tủ âm -20 °C (xem 4.1).

A.5. Dung dịch trypsin 0,5 %

A.5.1. Thành phần

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

0,5 g

 

Nước cất vô trùng

100 ml

 

A.5.2. Chuẩn bị

Hòa tan trypsin với nước cất trong chai thủy tinh vô trùng (xem 4.13), khuấy bằng máy khuấy từ (xem 4.8) qua đêm ở 4 °C, lọc vô trùng bằng màng lọc (xem 4.20). Bảo quản ở tủ âm -20 °C (xem 4.1).

A.6. Môi trường phát triển tế bào

A.6.1. Chun bị

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

18,78 g

 

Nước cất khử ion

2000 ml

 

Hòa tan MEM với nước ct khử ion trong chai thủy tinh vô trùng (xem 4.13), hấp tiệt trùng ở 121 °C trong 15 min và bảo quản ở 4 °C. Sau đó bổ sung các chất để được môi trường sử dụng cho nuôi cấy tế bào.

A.6.2. Pha môi trường tế bào (đ sử dụng)

MEM

2000 ml

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

L-glutamin 3 %

20 ml

 

NaHCO3 7 %

40 ml

 

Gentamicin 40 mg/ml

80 mg

 

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

A.6.3. Chuẩn bị môi trường phát triển tế bào MEM có 5 % FCS

MEM (để sử dụng)

200 ml

 

FCS

10 ml

 

A.6.4. Chun bị môi trường phát triển tế bào MEM có 10 % FCS

MEM (để sử dụng)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

 

FCS

10 ml

 

A.6.5. Chuẩn bị môi trường cất giữ tế bào

MEM (để sử dụng)

7 ml

 

FCS

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

 

DMSO

1 ml

 

A.7. Chuẩn bị mồi

- Mồi đông khô phải được ly tâm ngắn để chắc chắn rằng mi được lắng xuống đáy ống trước khi m và hoàn nguyên. Lần đầu tiên nên dùng dung dịch đệm TE để hoàn nguyên mồi ở nồng độ 200 pmol/μl làm gốc.

- Mồi sử dụng ở nồng độ 10 pmol/μl: pha loãng mồi gốc bằng nước tinh khiết không có nuclease.

Mi gốc

10 μl

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Nước tinh khiết không có nuclease

90 μl

 

Tổng lượng

100 μl

 

 

PHỤ LỤC B

(Tham khảo)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

B.1. Chiết tách ARN

Hiện nay có rất nhiều các loại kít chiết tách khác nhau được cung cấp trên thị trường. Nếu sử dụng kít chiết tách Qiagen RNearsy minikit thì các bước chiết tách được thực hiện như sau:

a) Chun b

Chuẩn bị dung dịch RLT (600 μl/mẫu) vào ống ly tâm 50 ml vô trùng (xem 4.14). Thêm 1/100 β- mercaptoetanol (β-ME) vào dung dịch RLT (sau khi bổ sung β-ME, dung dịch RLT này có thể giữ được 1 tháng ở nhiệt độ phòng).

b) Tiến hành chiết tách

Lắc mẫu trong 5 s bằng máy lắc rồi ly tâm nhanh. Cho 600 μl dung môi RLT đã bổ sung β-ME vào ống giữ mẫu 1,5 ml (xem 4.23).

Chuyển 200 μl mẫu sang ống giữ mẫu 1,5 ml (xem 4.23). Lắc ống 1,5 ml bằng máy lắc trong 15 s và ly tâm nhanh.

Thêm 400 μl ethanol 100 % (cồn tuyệt đối) và lắc trong 15 s. Ly tâm ở gia tốc 8000g trong 1 min ở nhiệt độ phòng.

Chuyển 600 μl hỗn hợp dung dịch ở trên vào ống cột lọc (spin column) có trong bộ kit. Ly tâm ở gia tốc 8000g trong 1 min. Vứt bỏ phần ống thu dung dịch ở dưới, chuyển phn cột lọc phía trên sang ống thu mới. Chuyển nốt 600 μl hỗn hợp dung dịch còn lại vào trong cột lọc. Ly tâm ở gia tốc 8000g trong 1 min.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Rửa lần 1: Cho 700 μl dung dịch RW1 vào cột lọc. Ly tâm ở gia tốc 8000g trong 1 min.

Vứt b phần ống thu dung dịch ở dưới, chuyển phần cột lọc phía trên sang ống thu mới.

Rửa lần 2: Cho 500 μl dung dịch RPE vào cột lọc, ly tâm ở gia tốc 8000g trong 1 min. Đổ bỏ phần dung dịch ở dưới, giữ lại ống thu, cho tiếp 500μl dung dịch RPE vào cột lọc, ly tâm ở gia tốc 8000g trong 1 min.

Đặt cột lọc vào ống thu mới. Ly tâm cột lọc ở gia tốc 14 000g trong 2 min.

Thu ARN: Chuyển cột lọc sang ống giữ mẫu 1,5 ml mới. Cho 50 μl nước không chứa nuclease vào cột lọc, ủ 1 min ở nhiệt độ phòng. Ly tâm 1 min ở gia tốc lớn hơn 10 000g.

Chuyển mẫu ARN đã thu sang ống giữ mẫu 1,5 ml mới.

Cất giữ ARN: Có thể giữ ARN ở 4 °C trong vài giờ nếu sử dụng ngay hoặc cất giữ ở nhiệt độ - 20 °C nếu chưa dùng ngay trong ngày.

B.2. Tiến hành phn ứng rRT-PCR

a) Tiến hành pha master mix

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Master mix được chuẩn bị theo hướng dẫn của nhà sản xuất kít như sau:

Qiagen one-step RT-PCR kít

Invitrogen SS3 qRT-PCR kít

Nguyên liệu

Thể tích (μl)

Nguyên liệu

Th tích (μl)

H2O

10,5

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

4,5

Dung dịch đệm 5x

5,0

Dung dịch đệm 2x

12,5

MgCI2 25 mM

1,2

MgCI2 50 mM

1,0

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

0,8

 

 

PPP (mồi ngược, mồi xuôi và mẫu dò)

1,5

PPP (mi ngược, mồi xuôi và mẫu dò)

1,5

Enzym

1,0

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

0,5

Sau khi chuẩn bị xong master mix:

- Cho 20 μl master mix vào ống PCR.

- Cho 5 μl mẫu ARN vào ống PCR.

- Đặt ống PCR vào máy nhân gen real-time PCR machine (xem 4.11).

- Chạy chương trình.

- Chọn đọc màu ở bước kéo dài.

b) Chạy phản ứng

Chu kỳ nhiệt chạy phản ứng được cài đặt trên máy nhân gen (xem 4.11) theo hướng dẫn của nhà sản xuất kít sử dụng trong phản ứng. Đối với kít Qiagen one-step RT-PCR và Invitrogen superscript3 qRT- PCR, chu kỳ nhiệt cài đặt như sau:

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Invitrogen superscript 3 qRT-PCR Kít

RT

PCR

RT

PCR

50 °C, 30 min; 95 °C, 15 min

Chu trình 40 vòng (95 °C, 10 s + 60 °C, 50 s)

50 °C, 15 min; 95 °C, 2 min

Chu trình 40 vòng (95 °C, 10 s + 60 °C, 50 s)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Kết quà chạy rRT - PCR được công nhận khi:

- Đối chứng dương tính cho giá trị Ct đã biết (± 2).

- Đối chứng âm tính không có Ct.

- Mẫu được coi là dương tính khi có Ct ≤ 35.

- Mẫu được coi là âm tính nếu không có Ct.

- Mẫu được coi là nghi ngờ nếu Ct >35, trường hợp này phải xét nghiệm lại hoặc dùng phương pháp khác (phân lập vi rút) để khẳng định.

 

PHỤ LỤC C

(Quy định)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

C.1. Chuẩn bị

- Lợn con khỏe mạnh dưới 8 tuần tuổi, thuộc đàn miễn nhiễm với bệnh PRRS hoặc là lợn SPF.

- Dung dịch PBS pH 7,2 (xem phụ lục A) cha 1 % dung dịch kháng khuẩn (xem phụ lục A).

- Dung dịch trypsin 0,25 % (pha loãng 2 lần Trypsin 0,5 % với PBS pH 7,2).

- Môi trường tế bào MEM và FCS.

- Dao, panh, kéo, chai thủy tinh vô trùng.

C.2. Tiến hành

- Mổ lợn, tiến hành lấy phổi lợn một cách vô trùng (chú ý không được làm rách phổi). Sau đó tiến hành các bước để thu hoạch tế bào PAM trong buồng cấy an toàn sinh học cấp 2 (xem 4.4).

- Rửa phổi lợn bng cách đổ dung dịch PBS pH 7,2 có chứa 1 % dung dịch kháng khuẩn với lượng 200 ml/lần vào ng khí quản, dùng tay bóp nhẹ phổi để rửa. Sau đó dốc ngược phổi vào chai thủy tinh vô trùng để thu lại toàn bộ phần nước rửa phổi này.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Các lần rửa phổi phải được tiến hành cn thận và vô trùng.

- Sau 3 lần rửa phổi vô trùng sẽ thu hoạch được nước rửa phổi có chứa tế bào đại thực bào PAM trong chai thủy tinh vô trùng.

- Chuyển toàn bộ phần dung dịch rửa phổi có chứa tế bào thu được sang ống ly tâm 50 ml vô trùng, ly tâm ở gia tốc 1500g trong 10 min.

-Đổ bỏ phần nước trên, giữ lại phần tế bào sơ cấp PAM lắng ở đáy ống ly tâm, rửa và ly tâm 1 lần nữa với dung dịch PBS.

- Pha loãng tế bào với môi trường phát triển MEM có 10 % FCS (xem phụ lục A) và đếm tế bào để được lượng tế bào cần thiết tối thiểu là 4 x 107 tế bào/1 ml.

- Chuẩn bị môi trường phát triển MEM có 10 % FCS (xem phụ lục A), chia vào các chai nuôi tế bào với lượng cần thiết (20 ml trên chai 75 cm2, 10 ml trên chai 25 cm2). Sau đó dùng pipet chuyển dung dịch môi trường có chứa tế bào ở trên vào các chai với lượng 5ml trên chai 75 cm2, 3 ml trên chai 25 cm2.

- Đối với đĩa nuôi tế bào (đĩa 24 giếng hoặc 96 giếng) thi tế bào được pha loãng luôn vi môi trường phát triển tế bào MEM có 10 % FCS, rồi chia vào các giếng với t lệ theo quy định đ đảm bảo tối thiểu có 5 x 104 tế bào/ml. (Với đĩa 24 giếng là 1 ml/ giếng, với đĩa 96 giếng là 100 μl/giếng).

- Sau đó nuối ở tủ ấm 37 °C có 5 % CO2. Sau 1 ngày đến 2 ngày đổ bỏ môi trường cũ, rửa sạch thảm tế bào bằng dung dịch PBS, cho tiếp môi trường phát triển tế bào MEM có 10 % FCS mới vào nuôi tiếp. Khi tế bào mọc đạt từ 80 % đến 90 % thì có thể sử dụng.

C.3. Chuyn đời tế bào

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Cho 5 ml dung dịch Trypsin 0,1 % vào và ở 37 °C trong 2 min đến 5 min để tế bào bong ra khỏi bề mặt chai nuôi cấy. Có thể vỗ nhẹ vào thành chai nuôi cấy để tế bào bong ra hết.

- Cho thêm 10 ml môi trường phát triển tế bào MEM có 5 % FCS (xem phụ lục A) (huyết thanh trong môi trường phát triển tế bào sẽ vô hoạt trypsin), rồi hút toàn bộ dung dịch này sang ống ly tâm 50 ml.

- Ly tâm ở gia tốc 1500 g trong 5 min.

- Hút bỏ phần dịch nổi. Giữ lại phần tế bào lắng cặn ở dưới. Cho tiếp 10 ml môi trường phát triển tế bào MEM có 5 % FCS vào. Trộn đều bằng cách dùng pipet hút lên và hút xuống.

- Chia đều dung dịch chứa tế bào này sang các chai nuôi cấy có chứa môi trường phát triển tế bào MEM có 5 % FCS mới với lượng 5 x 104 tế bào/ml. đĩa ở tủ ấm 37 °C có 5 % CO2, từ 5 ngày đến 7 ngày. Theo dõi tế bào phát triển hàng ngày và loại bỏ ngay những chai tế bào bị nhiễm khuẩn.

- Chuyển đời tế bào theo tỷ lệ 1:5. Lượng tế bào từ 1 chai 75 cm2 đạt 100 % diện tích nuôi cấy có thể chuyển đời sang 5 chai 75 cm2 khác.

- Nếu tế bào phát triển kém, hút b môi trường phát triển tế bào cũ, rửa thảm tế bào bằng dung dịch đệm PBS rồi đưa môi trường phát triển tế bào mới vào.

C.4. Đông lạnh tế bào

- Hút bỏ môi trường cũ, thêm 20 ml dung dịch PBS để rửa lớp tế bào, sau đó hút bỏ dung dịch rửa này.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Cho thêm 10 ml môi trường phát triển tế bào MEM 5 % FCS (xem phụ lục A) (huyết thanh trong môi trường phát triển tế bào sẽ vô hoạt trypsin), rồi hút toàn bộ dung dịch này sang ống ly tâm 50 ml.

- Ly tâm ở gia tốc 1500g trong 5 min.

- Đổ bỏ phần dung dịch nổi, hòa phần tế bào lắng cặn trong 4 ml môi trường cất giữ tế bào (xem phụ lục A) và dùng pipet trộn đều nhẹ bằng cách hút nhả nhiều lần (tránh bọt).

- Chuyển 4 ml dung dịch tế bào trên vào ống đông lạnh cryo (4,5 ml). Bọc ống đông lạnh trong bông vô trùng hoặc giấy vô trùng để làm chậm quá trình đông lạnh. Đặt ống đông lạnh vào tủ âm có nhiệt độ 50 °C đến -90 °C qua đêm, sau đó chuyển vào giữ ở nitơ lỏng.

C.5. Khôi phục tế bào

- Lấy ống tế bào được bo quản đông lạnh trong nitơ lỏng ra và rã đông nhanh chóng bằng cách đặt vào nước ấm 35 °C đến 39 °C trong 1 min.

- Chun bị chai nuôi tế bào 25 cm2 với 10 ml môi trường phát triển tế bào MEM có 10 % FCS (xem phụ lục A).

- Khi tế bào đã rã đông, nhanh chóng dùng pipet hút dung dịch tế bào sang ống ly tâm 15 ml và cho tiếp vào 10 ml môi trường phát triển tế bào MEM có 10 % FCS, trộn đều bằng pipet hút lên, hút xuống nh nhàng để tránh bọt.

- Ly tâm ở gia tốc 1500 g trong 5 min.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Chuyển toàn bộ dung dịch tế bào này vào chai nuôi tế bào 25 cm2 chứa 10 ml môi trường phát triển tế bào MEM có 10 % FCS. ở t ấm 37 °C chứa 5 % CO2.

- Qua một ngày, đổ bỏ môi trường cũ để loại nốt DMSO (Dimethylsulfoxide), rửa lớp tế bào bằng dung dịch PBS rồi cho môi trường phát triển tế bào mới MEM có 5 % FCS vào. ở t ấm 37 °C có 5 % CO2 để tế báo phát triển.

 

PHỤ LỤC D

(Tham khảo)

Phương pháp ELISA phát hiện kháng thể PRRS

Hiện nay có rất nhiều các loại kít phát hiện kháng thể PRRS khác nhau được cung cp trên thị trường nên khi sử dụng tuân theo quy trình của nhà sản xuất.

Nếu sử dụng bộ kit chẩn đoán PRRS-HERDCHECK X3 của IDEXX thì các bước tiến hành được thực hiện như sau:

- Bưc 1: Chuẩn bị bộ kit: số mẫu huyết thanh cần kiểm tra (xem 5.2.3.1) + 02 đi chứng dương + 02 đối chứng âm.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

* Nhỏ 100 μl đối chứng âm và đối chứng dương (không pha loãng) vào đĩa ELISA theo vị trí bố trí.

- Bước 3: Vỗ nhẹ đĩa, đậy nắp. ở nhiệt độ phòng trong 30 min.

- Bước 4: Pha nước rửa đĩa 1X từ dung dịch rửa đĩa 10X có sẵn trong bộ kit với nước cất.

- Bước 5: Sau 30 min đĩa, đổ bỏ dung dịch trong đĩa, rửa đĩa 3 lần với lượng 300 μl/giếng bằng dung dịch rửa đĩa 1X.

- Bước 6: Nhỏ 100 μl chất gắn kết (conjugate) vào tất cả các giếng. tiếp đĩa ở nhiệt độ phòng trong 30 min.

- Bước 7: Sau đó đổ bỏ dung dịch trong đĩa, rửa đĩa 3 lần với lượng 300 μl/giếng bằng dung dịch ra đĩa 1X.

- Bước 8: Nhỏ 100 μl cơ cht vào các giếng, ủ đĩa trong 15 min.

- Bước 9: Dừng phản ứng bằng cách cho 100 μl dung dịch stop vào các giếng.

- Bước 10: Đọc đĩa ở bước sóng 650 nm và tính kết quả.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

+ OD của đối chứng âm ≤ 0,15

+ OD của đi chứng dương - OD của đối chứng âm ≥ 0,15

S/P = (OD của mẫu - OD của đối chứng âm)/(OD của đối chứng dương - OD của đi chứng âm)

Đánh giá kết quả:

+ mẫu dương tính:         S/P không nhỏ hơn 0,4.

+ mẫu âm tính:              S/P nh hơn 0,4.

Sơ đồ đĩa

 

1

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

3

4

5

6

7

8

9

10

11

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

A

ĐC(-)

S4

S11

S18

S25

S32

S39

S46

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

S60

S67

S74

B

ĐC(-)

S5

S12

S19

S26

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

S40

S47

S54

S61

S68

S75

C

ĐC(+)

S6

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

S20

S27

S34

S41

S48

S55

S62

S69

S76

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

ĐC(+)

S7

S14

S21

S28

S35

S42

S49

S56

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

S70

S77

E

S1

S8

S15

S22

S29

S36

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

S50

S57

S64

S71

S78

F

S2

S9

S16

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

S30

S37

S44

S51

S58

S65

S72

S79

G

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

S10

S17

S24

S31

S38

S45

S52

S59

S66

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

S80

CHÚ THÍCH: - ĐC (-): mu đi chng âm.

- ĐC (+): mẫu đối chứng dương.

- S1, S2, S3,…,S80: mu huyết thanh cn kim tra s 1, số 2, s 3.... đến mẫu số 80.

 

PHỤ LỤC E

(Quy định)

Công thức tính liều gây nhiễm 50 % tế bào thí nghiệm (TCID50) của Reed Muench

Công thức tính liều gây nhiễm 50 % tế bào thí nghiệm (TCID50) của Reed Muench:

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Với X được tính như sau:

Trong đó:

A là tỷ lệ giếng tế bào nhiễm sát trên 50 %, tính bằng phần trăm (%).

B là tỷ lệ giếng tế bào nhiễm sát dưới 50 %, tính bằng phần trăm (%).

a là nồng độ pha loãng vi rút tại A (ly giá trị số mũ),

b là nng độ pha loãng vi rút tại B (lấy giá trị số mũ).

DỤ:

Trong 100 μl dung dịch pha loãng vi rút nhiễm vào mỗi giếng có:

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Vậy TCID50 là: 107,68/ 100l μl dung dịch pha loãng vi rút.

CHÚ THÍCH: Cách tính liều gây chết 50 % trứng thí nghiệm (EID50) hay liều gây chết 50 % động vật thí nghiệm (LD50) cũng tương tự như trên.

 

THƯ MỤC TÀI LIỆU THAM KHẢO

[1] O.I.E., 2010, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, Porcine Reproductive and Respiratory syndrome, chapter 2.8.7.

[2] Bộ Nông nghiệp và PTNT - Viện Thú y Quốc gia - Tổ chức hợp tác quốc tế Nhật Bản JICA (2002). Hội chứng rối loạn sinh sn hô hấp. Trong Cẩm nang chn đoán tiêu chuẩn về các bệnh gia súc ở Việt Nam (trang 102-103).

Văn bản này chưa cập nhật nội dung Tiếng Anh

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Tiêu chuẩn quốc gia TCVN 8400-21:2014 về Bệnh động vật - Quy trình chẩn đoán - Phần 21: Hội chứng rối loạn sinh sản và hô hấp ở lợn (PRRS)

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


1.935

Địa chỉ: 17 Nguyễn Gia Thiều, P. Võ Thị Sáu, Q.3, TP.HCM
Điện thoại: (028) 3930 3279 (06 lines)
E-mail: info@ThuVienPhapLuat.vn

DMCA.com Protection Status
IP: 3.233.217.106