Từ khoá: Số Hiệu, Tiêu đề hoặc Nội dung ngắn gọn của Văn Bản...

Đăng nhập

Quên mật khẩu?   Đăng ký mới
Đăng nhập bằng Google

Số hiệu: TCVN8400-37:2015 Loại văn bản: Tiêu chuẩn Việt Nam
Nơi ban hành: *** Người ký: ***
Ngày ban hành: Năm 2015 Ngày hiệu lực:
Tình trạng: Đã biết

Bệnh

Biểu hiện

Viêm phổi địa phương lợn

Phổi viêm, thường quan sát thấy ở thùy đnh, thùy tim, thùy hoành hai bên phổi. Bệnh tích có tính chất đối xứng, giới hạn rõ rệt giữa vùng phổi viêm và vùng phổi lành. Ở những ca bệnh nặng, bệnh tích có thể lan tràn khắp phổi. Màu sắc phổi tiến triển dần từ màu tím rồi chuyển màu xám nhạt, phổi cứng dần: bị gan hóa, nhục hóa.

Tụ huyết trùng

Bệnh diễn biến rất nhanh trong vòng 12 h đến 24 h, lợn sốt cao 41 °C, nm yên một chỗ, b ăn, thở khó có thể sưng ở hầu và xuất hiện những vết đỏ (nâu, tím) ở cuống tai, c, da bụng, lưng... Chảy nhiều nước mũi, lúc đu loãng, sau đặc dần, có thể có mủ hoặc đôi khi có máu, rt khó th. Mổ khám thấy phổi viêm, xuất huyết hoặc phổi cứng như gan (gan hóa).

Viêm phổi, màng phổi (APP)

Biểu hiện như sốt, bỏ ăn: có trường hợp chết đột ngột vi dấu hiệu chy máu có bọt khí ở mũi; thở khó, thở thể bụng; ngồi kiu chó ngồi; tai tím tái (tai xanh); lợn thường chết do suy tim, viêm phổi hoại t và do độc tố của vi khuẩn. Có khi cũng có các triệu chứng như suy nhược cơ th, gầy còm, lông xù; đau đớn khi th; ho ngắn (3 tiếng ho), đây là đặc đim phân biệt với các bệnh khác. Viêm phổi và màng phổi hóa sợi, dính sườn; Áp xe phổi, phổi bị hoại t với những vùng bị hoại t xanh đỏ rất đặc trưng. Xoang ngực chứa đầy dịch.

6. Chẩn đoán trong phòng thí nghiệm

6.1. Phương pháp parafin phát hiện bệnh viêm phổi địa phương ở lợn

6.1.1. Lấy mẫu

Chọn lợn nghi bệnh mổ lấy các mẫu bệnh phẩm sau:

- Phổi: lấy phần phổi nghi có bệnh tích ở thùy tim, thùy đnh, thùy hoành hai bên với độ dày lát cắt khoảng 0,5 cm và độ rộng khoảng 1 cm đến 2 cm, độ dài khoảng 1 cm đến 2 cm;

- Hạch phổi: cắt một miếng với độ dày khoảng 0,5 cm.

Các mẫu bệnh phẩm trên cho vào lọ chứa formalin (3.1.1) sao cho thể tích mẫu bệnh phẩm và formalin có tỷ lệ khoảng 1 : 10, ghi ký hiệu mẫu trên thành lọ.

CHÚ THÍCH: Đồng thời kèm theo Phiếu gửi bệnh phm ghi rõ yêu cu xét nghiệm và những thông tin về dịch tễ các biểu hiện triệu chứng, bệnh tích của bệnh.

6.1.2. Bảo quản mẫu

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

6.1.3. Chuẩn bị mẫu

- Mẫu bệnh phẩm được cố định trong dung dịch formalin (3.1.1) thời gian 24 h;

- Cắt các bệnh phẩm đã cố định trên thành miếng nh dày khoảng 1 mm, dài khoảng 1 cm rồi đặt vào khuôn nhựa (4.2.1).

6.1.4. Cách tiến hành

6.1.4.1. Đúc khuôn

- Rửa khuôn nhựa (6.1.3) dưới vòi nước chảy, thời gian từ 2 h đến 3 h;

- Ngâm khuôn nhựa vào cốc etanol 70 % (thể tích) (3.1.2), thời gian từ 2 h đến 3 h;

- Ngâm khuôn nhựa vào cốc etanol 90 % (thể tích) (3.1.2) thời gian từ 2 đến 3 h;

- Ngâm khuôn nhựa vào cốc etanol tuyệt đối (3.1.2) lần th 1, thời gian từ 2 h đến 3 h;

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Ngâm khuôn nhựa vào cốc xylen (3.1.3) ln thứ 1, thời gian từ 2 h đến 3 h;

- Ngâm khuôn nhựa vào cốc xylen (3.1.3) lần thứ 2, thời gian từ 2 h đến 3 h;

- Ngâm khuôn nhựa vào cc parafin (3.1.6) ln thứ 1, thời gian từ 2 h đến 3 h;

- Ngâm khuôn nhựa vào cốc parafin (3.1.6) lần thứ 2, thời gian từ 2 h đến 3 h;

CHÚ THÍCH: Nếu sử dụng máy chuyển mẫu mô t động (4.1.2) thì tiến hành tiếp theo t bước ngâm etanol.

- Đúc khuôn: rót parafin (3.1.6) nóng chảy từ nồi đun parafin (4.2.3) vào khay sắt (4.2.4), gắp bệnh phm từ khuôn nhựa vào khay st, đặt khuôn nhựa (4.2.1) lên trên. Để nguội, tách lấy khối parafin.

6.1.4.2. Cắt tiêu bản

- Cắt gọt khối parafin (6.1.4.2) cho bằng phẳng, đặt trên mặt máy làm lạnh tiêu bn (4.2.5);

- Đặt khối parafin lên máy cắt tiêu bản (4.2.6) sao cho mặt khối parafin song song vi mép lưỡi dao, cắt bỏ những lát đầu đến khi lát ct có đủ các bệnh phẩm, điều chỉnh độ dày của lát cắt từ 3 µm đến 5 µm, cắt một vài lát;

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

6.1.4.3. Nhuộm tiêu bản

- Ngâm tiêu bản (6.1.4.2) vào cốc xylen (3.1.3) 3 lần, thời gian mỗi lần t 3 min đến 5 min;

- Ngâm tiêu bản vào cốc etanol tuyệt đối (3.1.2) 2 ln, thời gian mỗi lần từ 3 min đến 5 min;

- Ngâm tiêu bản vào cốc etanol 90 % (thể tích) (3.1.2), thời gian từ 3 min đến 5 min;

- Ngâm tiêu bản vào cốc etanol 70 % (th tích) (3.1.2), thời gian từ 3 min đến 5 min;

- Rửa tiêu bản dưới vòi nước chảy, thời gian từ 3 min đến 5 min;

- Ngâm tiêu bản vào cốc thuốc nhuộm haematoxylin (3.1.4), thời gian từ 3 min đến 5 min;

- Rửa tiêu bản dưới với nước chảy, thời gian t 3 min đến 5 min;

- Ngâm tiêu bản vào cốc thuốc nhuộm eosin (3.1.5), thời gian từ 60 s đến 90 s;

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Loại b nước còn bám trên tiêu bản bằng cách ngâm tiêu bản vào cc etanol 90 % (thể tích) (3.1.2) trong thời gian từ 3 s đến 5 s, sau đó ngâm tiêu bản vào cốc etanol tuyệt đối (3.1.2) 3 lần, thời gian mỗi lần từ 3 s đến 5 s; chuyển tiêu bản ngâm trong cốc xylen (3.1.3) 2 lần, thời gian mỗi lần từ 2 min đến 3 min; gn lamen (4.2.9) vào tiêu bản bằng keo dán lamen (3.1.7). Đkhô, soi tiêu bản dưới kính hiển vi quang học (4.2.11).

6.1.5. Đọc kết quả[3]

Đặc điểm bệnh tích vi thể của bệnh là viêm phi ở thể mạn tính với đặc trưng các tế bào lympho, bạch cầu đơn nhân xâm nhập vùng xung quanh phế quản, tiểu phế quản và mạch quản. Bệnh tích lan rộng tới c các nang lympho xung quanh phế quản. Các nang lympho có dạng trung tâm sinh trưng.

- Giai đoạn đầu của bệnh: thường thấy các tế bào bạch cầu đơn nhân lớn tp trung trong lòng phế qun;

- Có thể quan sát thấy viêm kẽ phổi, vách phế nang dày do xâm lấn của số lượng lớn các tế bào đơn nhân và đa nhân;

- Trong lòng phế nang có chứa các mnh tế bào;

- Các phế nang có thể chứa dịch phù màu hồng, hoặc xẹp xuống hoặc khí thũng.

6.2. Phương pháp realtime PCR phát hiện Mycoplasma hyopneumoniae

6.2.1. Ly mẫu

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

CHÚ THÍCH: Đng thời kèm theo Phiếu gửi bệnh phẩm ghi rõ yêu cầu xét nghiệm và những thông tin về dịch tễ, các biểu hin triệu chứng, bệnh tích của bệnh.

6.2.2. Bảo quản mẫu

Mu bệnh phẩm (6.2.1) được bo quản trong thùng lạnh (nhiệt độ từ 2 °C đến 8 °C). Mu được gửi đến phòng thí nghiệm không quá 48 h. Trong phòng thí nghiệm, nếu mẫu chưa xét nghiệm ngay phải được bảo quản trong t âm 20 °C (4.1.1).

6.2.3. Chuẩn bị mẫu

Mẫu bệnh phẩm phổi: lấy khoảng 1 g phi (6.2.1), ct nhỏ rồi nghiền thành huyễn dịch với dung dịch PBS (3.2.5) theo tỉ lệ 1 : 10 (thể tích) trong cối chày sứ (4.3.3). Ly tâm huyễn dịch bng máy ly tâm (4.3.2) ở gia tốc 3 000 g trong 5 min. Hút ly dịch nổi để tiến hành tách chiết ADN cho phn ứng realtime PCR.

6.2.4. Cách tiến hành

6.2.4.1. Tách chiết ADN

Sử dụng bộ kít tách chiết (3.2.1) thích hợp và an toàn theo hướng dẫn của nhà sản xuất.

VÍ DỤ: sử dụng kít tách chiết QIAGEN RNeasy Blood tissue (Cat. No. 69506)[1]) (xem Ph lục B).

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Phản ng khuếch đại được thực hiện trong máy nhân gen (4.3.1) theo phương pháp realtime PCR khuếch đại đoạn gen đặc hiệu của Mycoplasma hyopneumoniae sử dụng cặp mồi và mẫu dò (primers và probe) (3.2.3) được nêu trong Bảng 2.

Bng 2 - Cặp mồi, mu dò[4]

Mu dò, mồi

Trình tự từ 5’ đến 3'

Mu dò

FAM - CCGGAATTGATAGCTCAAATTACGAA - BHQ1

Mồi xuôi

TGCCGGTGAATGTTTCTG

Mồi ngược

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Mồi và mẫu dò được chuẩn bị như sau:

- Chuẩn bị mồi gốc và mẫu dò gốc: mồi và mẫu dò ở trạng thái đông khô phải được ly tâm nhanh bằng máy spindown (4.3.4) ở gia tốc 6 000 g trong 30 s để mồi lắng xuống đáy ống trước khi m và hoàn nguyên. Lần đầu tiên nên dùng dung dịch đệm TE (3.2.7) để hoàn nguyên mồi và mu dò ở nồng độ 100 µM làm mồi gốc và mẫu dò gốc;

- Chuẩn bị mồi sử dụng ở nồng độ 20 µM: pha loãng mồi gốc bằng nước (3.2.8) (20 µl mồi gốc và 80 µl nước (3.2.8));

- Chuẩn bị mẫu dò sử dụng ở nồng độ 6 µM: pha loãng mẫu dò gốc bng nước (3.2.8) (6 µl mẫu dò gốc và 94 µl nước (3.2.8)).

6.2.4.3. Tiến hành phản ứng realtime PCR

Sử dụng cặp mồi và mẫu dò đã được chuẩn bị (6.2.4.2).

Sử dụng kít nhân gen theo hướng dẫn của nhà sản xuất.

DỤ: dùng kít nhân gen của Bảng Invitrogen Platinum One - Step qPCR SuperMix - UDG (Cat. No. 11730-017) [2]) thành phần cho 1 phản ứng được nêu trong bảng 3.

Bảng 3 - Thành phần phản ứng realtime PCR

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Thể tích

µl

Nước tinh khiết không có nuclease

6,0

PCR SuperMix

12,5

Mồi xuôi (20 µM)

0,5

Mồi ngược (20 µM)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Mẫu dò (6 µM)

0,5

Tổng thể tích

20,0

Chuyển 20 µl hỗn hợp nhân gen vào mỗi ống phản ứng.

- Mẫu kiểm chứng dương: cho 5 µl mẫu ADN có giá trị Ct đã biết trước vào ống phản ứng.

- Mẫu kiểm chứng âm: cho 5 µl nước tinh khiết không có nuclease vào ống phản ứng.

- Mẫu bệnh phm: cho 5 µl mu ADN (phụ lục B) vào ống phn ứng.

CHÚ Ý:

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Mẫu nguyên vt liệu cho phản ứng realtime PCR cn đặt trong khay đá lạnh trong suốt quá trình chun bị hỗn hp phản ứng.

Tiến hành phản ứng bằng máy realtime PCR (4.3.1) đã được cài đặt chu trình nhiệt nêu trong Bảng 4.

Bảng 4 - Chu trình nhiệt phản ứng realtime PCR

Nhiệt độ

Thời gian

Số chu kỳ

50 °C

2 min

1 vòng

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

5 min

95 °C

10 s

40 vòng

60 °C

50 s

40 vòng

6.2.5. Đọc kết quả

Đọc kết quả bằng máy reatime PCR (4.3.1) dựa trên giá trị Ct (Ct là thời điểm máy đọc realtime PCR ghi nhn tín hiệu huỳnh quang phát ra từ ống phản ứng bắt đầu vượt qua cưng độ huỳnh quang nền)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Với điều kiện như trên, mẫu có giá trị Ct 35 được coi là dương tính; mẫu không có Ct được coi là âm tính; mẫu có giá trị 35 < Ct 40 được coi là nghi ngờ;

Những mẫu nghi ngờ cn được xét nghiệm lại theo quy trình hoặc bng phương pháp khác để khẳng định.

6.3. Phát hiện kháng thể Mycoplasma hyopneumoniae bằng phương pháp ELISA

6.3.1. Lấy mu

Sử dụng xylanh 5 ml và kim tiêm 22G (hoặc 20G) vô trùng, ly từ 1,5 ml đến 2 ml máu của lợn nghi mắc bệnh viêm phổi địa phương nhưng chưa tiêm phòng vắc xin. Sau khi lấy, rút pittong lùi ra để tạo khoảng trống (hoặc bơm máu vào ống nghiệm vô trùng), ghi ký hiệu mẫu trên xylanh hoặc ống nghiệm rồi đặt nằm nghiêng 45° trong hộp đựng mẫu, để đông máu trong 1 h đến 2 h ở nhiệt độ bình thường, tránh ánh nắng trực tiếp.

CHÚ THÍCH: Không lấy mẫu huyết thanh lợn đã được tiêm vắc xin Mycoplasma hyopneumoniae đ xét nghiệm kháng thể vì phương pháp trong tiêu chuẩn này không phân biệt được kháng thể nhiễm t nhiên và kháng thể do tiêm vắc xin.

6.3.2. Bảo quản mẫu

Mẫu bệnh phẩm là huyết thanh của lợn nghi mắc bệnh (6.3.1) được bảo quản trong thùng lạnh (nhiệt độ từ 2 °C đến 8 °C) và gửi đến phòng thí nghiệm không quá 48 h. Trong trường hợp mẫu đến phòng thí nghiệm chưa được xét nghiệm ngay, phải được ly tâm bằng máy ly tâm (4.3.2), chắt lấy phn huyết thanh sang ống khác, bo quản trong tủ lạnh (4.1.2).

6.3.3. Chuẩn bị mẫu

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

6.3.4. Cách tiến hành

VÍ DỤ: dùng bộ kít phát hiện kháng thể Mycoplasma hyopneumoniae ở lợn của hãng IDEXX[3])

6.3.4.1. Chun bị nguyên liệu

- Nguyên liệu: các nguyên liệu của bộ kit được bảo quản ở nhiệt độ 4 °C, trước khi tiến hành phản ứng phải được đem ra để cân bằng với nhiệt độ phòng (từ 18 °C đến 26 °C);

- Mẫu huyết thanh (6.3.3): được pha loãng thành 1/40 với Sample Dilution (dung dịch pha loãng mẫu). (Lấy 10 µl huyết thanh pha với 390 µl dung dịch pha loãng mẫu);

- Pha loãng dung dịch Wash Concentrate 10 X (dung dịch rửa): lấy 1 phần dung dịch rửa 10 X pha với 9 phần nước cất;

- Tính thể tích dung dịch nước ra cần pha: 300 µl/giếng x 3 lần rửa x 2 bước rửa x số giếng sử dụng;

- Sơ đồ bố trí mẫu: trong sơ đồ bố trí mẫu phải có mẫu trắng (Blank), kiểm chứng âm (Negative Control - NC), kiểm chứng dương (Positive Control - PC).

6.3.4.2. Tiến hành phản ứng ELISA

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Nh 100 µl dung dch pha loãng mẫu vào giếng mẫu trắng;

- Nh 100 µl mẫu kiểm chứng âm vào giếng kiểm chứng âm;

- Nh 100 µl mẫu kiểm chứng dương vào giếng kiểm chứng dương;

- Nh 100 µl mẫu huyết thanh (6.3.4.1) đã pha loãng 1/40 vào các giếng thích hợp;

- Để dĩa ở nhiệt độ phòng trong 30 min;

- Đổ bỏ dung dịch trong đĩa;

- Nhỏ 300 µl dung dịch ra vào các giếng, rồi đổ b đi. Lặp lại 3 lần.

Bước 2: Nhỏ kháng kháng thể

- Nh 100 µl dung dịch kết hợp vào các giếng;

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Đổ bỏ dung dịch trong đĩa;

- Nh 300 µl dung dịch ra vào các giếng, rồi đổ bỏ đi. Lặp lại 3 lần.

Bước 3: Nh cơ chất

- Nh 100 µl dung dịch cơ chất TMB (Tetramethylbenzidine) vào các giếng;

- Đ đĩa ở nhiệt độ phòng trong 15 min.

Bước 4: Dừng phản ứng

- Nhỏ 100 µl dung dịch dừng phản ứng (Stop solution) vào các giếng;

- Đo giá trị mật độ quang học (OD) bng máy đọc ELISA (4.4.1) ở bước sóng 650 nm.

6.3.5. Đọc kết qu

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Giá trị OD của kiểm chứng dương tr giá trị OD của kiểm chứng âm phải lớn hơn hoặc bằng 0,15;

- Giá tr OD của kiểm chứng âm lớn hơn hoặc bằng 0,15.

Tính kết quả:

- Trung bình của kiểm chứng âm: (NC1 + NC2) / 2= NCx tb

- Trung bình của kiểm chứng dương: (PC1 + PC2) / 2 = PCx tb

- T lệ S/P = (giá trị OD của mu NCx tb) / (PCx tb – NCx tb)

- Hiệu giá của mu: Log10 Titer = 1.09 (log10 S/P) + 3.36

CHÚ THÍCH: S/P là tỉ lệ được tính toán gia giá trị OD của mẫu bệnh phm so với giá trị OD của mẫu kiểm chứng dương.

Đánh giá kết quả đi với mẫu bệnh phm:

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Mẫu huyết thanh âm tính với kháng thể Mycoplasma hyopneumoniae có S/P nhỏ hơn 0,30;

- Mẫu huyết thanh nghi ngờ có kháng thể Mycoplasma hyopneumoniae có S/P trong khoảng từ 0,30 đến 0,40 và phải được kiểm tra lại.

7. Kết luận

Ln được xác định mắc bệnh viêm phổi địa phương khi có các đặc điểm dịch tễ, triệu chứng lâm sàng, triệu chứng bệnh tích đặc trưng của bệnh và dương tính với một trong các phương pháp xét nghiệm quy định trong tiêu chun này.

 

Phụ lục A

(Quy định)

Chuẩn bị dung dịch muối đệm phosphat (PBS)

A.1. Thành phần

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

9,47 gm

 

Kali dihydrophosphat (KH2PO4)

9,08 gm

 

Nước ct

900 ml

 

A.2. Chuẩn bị

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

CHÚ THÍCH: Có thể sử dụng PBS thương mại và pha theo hướng dẫn của nhà sn xuất.

 

Phụ lục B

(Tham khảo)

Quy trình tách chiết ADN

CNH BÁO: Việc tách chiết ADN có sử dụng hóa chất nguy hiểm và có khả năng gây hại nếu thao tác không cn thận. Do vậy, nên tránh tiếp xúc trực tiếp với da và hít phải hơi của các hóa chất này. Luôn luôn đeo găng tay, khu trang, mặc quần áo bảo hộ khi thực hiện các thao tác này.

Quy trình tách chiết ADN sử dụng kít QIAGEN RNeasy Blood & Tissue kit (Cat. No. 69506) như sau:

B.1. Pha dung dịch

- Dung dịch AW1: thêm 125 ml etanol tuyệt đối (3.2.4) vào 95 ml dung dịch AW1 đậm đặc;

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

B.2. Cách tiến hành

- Cho 20 µl protease vào ống 1,5 ml;

- Chuyển 200 µl dịch mẫu (dịch ni xử lý ở 6.2.3) vào ng 1,5 ml;

- Thêm 200 pl dung dịch AL (lysis buffer) vào ống. Lc bằng máy lắc (4.1.3) trong 15 s, sau đó ly tâm (4.3.2) vi gia tốc 3 000 g trong 1 min;

- Ủ ấm ở 56 °C trong 10 min, sau đó ly tâm (4.3.2) với gia tc 3 000 g trong 1 min;

- Cho 200 µl etanol tuyệt đi (3.2.4) vào ống. Lắc bằng máy lắc (4.1.3) trong 15 s, sau đó ly tâm (4.3.2) với gia tốc 3 000 g trong 1 min;

- Chuyển 620 µl dung dịch mẫu đã tách chiết vào cột lọc (spin column) với ống thu (collection tube);

- Ly tâm (4.3.2.) với gia tốc 6 000 g trong 1 min ở nhiệt độ phòng;

- Thêm 500 µl dung dịch AW1 vào cột lọc có ống thu ở dưới;

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Cho cột lọc vào ống thu mới;

- Thêm 500 µl dung dịch AW2 vào cột lọc có ống thu ở dưới;

- Ly tâm (4.3.2) với gia tốc 20 000 g trong 3 min ở nhiệt độ phòng;

- Chuyển cột lọc sang ống ly tâm 1,5 ml;

- Nh 200 µl dung dịch AE vào cột ly tâm và giữ ở nhiệt độ phòng 1 min;

- Ly tâm (4.3.2) với gia tốc 6 000 g trong 1 min;

- Chuyển ADN đã thu được sang ng 1,5 ml mới

- Bo quản mẫu ADN ở 4 °C trong ngày nếu chạy phản ứng realtime PCR ngay và giữ ở âm 20 °C để lưu mẫu trong thi gian dài.

 

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

[1] JICA, 2003. Standard Diagnostic Manual for livestock diseases in Thailand. Third edition, p.110-111

[2] J.Quinn, M.E.Carter, B.Markey, G.R.Carter, 2004. Veterinary Clinical Microbiology. 6th Edition. Printed in Spain, p.320-326.

[3] Eileen L. Thacker, 2006. Chapter 42: Mycoplasmal Disease. Diseases of Swine. 9th Edition. Blackwell Publishing, p.701-707.

[4] Steven B. Kleiboeker, 2004. Development of Real-time, multiplex PCR/RT-PCR assays for improved PRDC pathogen detection - NPB. Available at: http://www.pork.org/FileLibrary/ResearchDocuments/03-114-KLEIBOEKER.6-28-04.pdf.

[5] IDEXX Laboratories, Herd Chek® Mycoplasma hyopneumoniae Antibody Test Kit.

[6] Nguyễn Vinh Phước, 1978. Giáo trình bệnh truyền nhiễm gia súc.

[7] Lê Văn Lãnh và cs, 2012. Tạp chí Khoa học kỹ thuật Thú y.

[8] Barbara E. Straw và cs, 2006. Diseases of swine.

[9] Nguyễn Bá Hiên, Huỳnh Thị Mỹ Lệ, Lê Văn Lãnh, Đỗ Ngọc Thúy, 2012. Giáo trình bệnh truyn nhiễm thú y. NXB Đại Học Nông Nghiệp.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

[11] Mycoplasmal Pneumonia in Pigs. Available at: http://www.thepigsite.com/pighealth/article/323/enzootic-pneumonia-ep-or-mycoplasma-hyopneumoniae-infection.

[12] M. Kobisch and N.F. Friis, “Swine mycoplasmoses”, Rev. sci. tech. Off. int. Epiz., 1996, 15 (4), 1569-1605. Available at: http://www.oie.int/doc/ged/D9110.PDF.

[1] Thông tin này đưa ra tạo điu kiện thuận tin cho người s dụng tiêu chuẩn và không ấn định sử dụng sản phẩm của nhà cung cp này. Có th sử dụng các sản phẩm tương tự nếu cho các kết quả tương đương.

[2] Thông tin này đưa ra tạo điều kiện thuận tin cho ngưi sử dụng tiêu chuẩn và không ấn định s dụng sn phm của nhà cung cấp này. Có thể s dụng các sn phẩm tương t nếu cho các kết qu tương đương.

[3]) Thông tin này đưa ra tạo điều kiện thuận tiện cho người sử dụng tiêu chuẩn và không n định sử dụng sản phẩm của nhà cung cp này. Có thể sử dụng các sản phẩm tương t nếu cho các kết quả tương đương

Văn bản này chưa cập nhật nội dung Tiếng Anh

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Tiêu chuẩn quốc gia TCVN 8400-37:2015 về Bệnh động vật - Quy trình chẩn đoán - Phần 37: Bệnh viêm phổi địa phương ở lợn

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


1.362

Địa chỉ: 17 Nguyễn Gia Thiều, P. Võ Thị Sáu, Q.3, TP.HCM
Điện thoại: (028) 3930 3279 (06 lines)
E-mail: info@ThuVienPhapLuat.vn

DMCA.com Protection Status
IP: 44.197.230.180