Từ khoá: Số Hiệu, Tiêu đề hoặc Nội dung ngắn gọn của Văn Bản...

Đăng nhập

Quên mật khẩu?   Đăng ký mới
Đăng nhập bằng Google

Số hiệu: TCVN8400-1:2010 Loại văn bản: Tiêu chuẩn Việt Nam
Nơi ban hành: *** Người ký: ***
Ngày ban hành: Năm 2010 Ngày hiệu lực:
Tình trạng: Đã biết

Na2HPO4.2H2O

 3,05 g

KH2PO4

 0,39 g

Nước cất

 500 ml

Đ phenol 1 %

 1 ml

- Kháng sinh:

Penicilline

1000 UI/ml

Mycostatine

100 UI/ml

Neomycine

100 UI/ml

Polymicine

50 UI/ml

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Chú ý: Khi dùng pha dung dịch bảo quản với glyxerin tỷ lệ 1:1

A.2. Dung dịch đệm

Dung dịch đệm carbonat/bicarbonat dung dịch đệm 0,05 M, pH 9,6

NaHCO3

 2,93 g/l

Na2CO3

 1,59 g/l

A.3. Dung dịch PBS 0,002 M, pH 7,4

Na2HPO4

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

KH2PO4

0,80 g/l

NaCl

32,00 g/l

KCl

0,80 g/l

A.4. Dung dịch đệm A: PBS 0,01 M + 0,05 % Tween 20, pH từ 7,2 đến 7,6

Na2HPO4

1,21 g/l

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

0,20 g/l

NaCl

8,00 g/l

KCl

0,20 g/l

A.5. Dung dịch đệm B: PBS 0,01 M + 0,05 % Tween 20 + 5 % sữa bột tách bơ, pH từ 7,2 đến 7,6

Na2HPO4

 1,21 g/l

KH2PO4

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

NaCl

 8,00 g/l

KCl

 0,20 g/l

A.6. Dung dịch kháng khuẩn

Hòa tan kháng sinh bằng nước cất rồi lọc màng lọc cỡ lỗ 0,45 mm, bảo quản ở ngăn đá tủ lạnh.

Penicilline

1.000.000 UI

Mycostatine

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Streptomycine

200 mg

Kanamicine

1.000.000 UI

Nước cất vô trùng

10 ml

A.7. Chuẩn bị mồi

- Mồi đông khô phải được ly tâm ngắn để chắc chắn rằng mồi được lắng xuống đáy ống trước khi mở và hoàn nguyên. Lần đầu tiên nên dùng đệm TE để hoàn nguyên mồi ở nồng độ 200 pmol/ml làm gốc.

- Mồi sử dụng ở nồng độ 20 pmol/ml: pha loãng mồi gốc bằng nước không có nuclease.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

10 ml

Nước không chứa RNAse

90 ml

Tổng lượng

100 ml

 

Phụ lục B

(Quy định)

Quy trình ELISA phát hiện kháng nguyên

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Gắn đĩa (coating): Kháng huyết thanh thỏ kháng virus lở mồm long móng của các typ O, A, C và Asia 1 pha loãng 1:1000 với dung dịch coating dung dịch đệm (Phụ lục A), nhỏ 50 ml vào các giếng tương ứng. Đậy nắp, ủ và lắc ở nhiệt độ 37 °C/1 h hoặc ủ qua đêm ở 4 °C.

- Rửa đĩa 3 lần bằng dung dịch rửa PBS 0,002M.

- Nhỏ 50 ml kháng nguyên đối chứng dương tính mạnh (1:10) và yếu (1:100) pha loãng bằng dung dịch đệm A (Phụ lục A) và mẫu bệnh phẩm vào các giếng quy định (Phụ lục B), ủ và lắc ở nhiệt độ 37 °C/1 h.

- Rửa 3 lần bằng dung dịch rửa PBS 0,002M (Phụ lục A)

- Nhỏ kháng thể phát hiện: Mỗi giếng nhỏ 50 ml kháng huyết thanh chuột lang kháng virus lở mồm long móng vào các giếng tương ứng, mỗi serotyp được pha loãng (1:100) với dung dịch đệm B (xem Phụ lục A). Đậy nắp, ủ và lắc ở nhiệt độ 37 °C/1 h.

- Rửa 3 lần bằng dung dịch rửa PBS 0,002 M (Phụ lục A)

- Nhỏ chất gắn kết (1:200 pha với dung dịch đệm B): 50 ml/giếng.

Đậy nắp, ủ và lắc ở nhiệt độ 37 °C/40 min.

- Rửa 3 lần bằng dung dịch rửa PBS 0,002 M (Phụ lục A)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Dừng phản ứng: nhỏ dung dịch H2SO4 1,25 M với 50 ml/giếng.

B.2. Đọc kết quả

Đọc bằng máy đọc ELISA có kính lọc 492 nm. Nếu giá trị OD > 0,1 sau khi đã trừ đi giá trị trung bình của cột trắng thì phản ứng được coi là dương tính với serotyp đó.

Nếu OD = 0,1 thì cấy chuyển mẫu bệnh phẩm lên môi trường tế bào rồi kiểm tra lại.

Sơ đồ đĩa phản ứng ELISA phát hiện kháng nguyên

 

Phụ lục C

(Quy định)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

C.1. Chiết tách ARN

Theo hướng dẫn của nhà sản xuất.

C.2. Tiến hành phản ứng RT-PCR

C.2.1. Công thức

Áp dụng cho kit RT-PCR 1 bước của hãng Qiagen (nếu dùng kit khác có thể phải thay đổi công thức pha chế)

Nguyên liệu

Thể tích (ml)

H2O

12,0

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

5,0

dNTP

1,0

Hỗn hợp enzym

1,0

Mồi xuôi

0,5

Mồi ngược

0,5

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

5,0

Tổng cộng

25,0

 

FMDV-

Uni

Mồi

Chiều

Chuỗi (5’ - 3’)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

1R

Ngược

CCA GTC CCC TTC TCA GAT C

328

1F

Xuôi

GCC TGG TCT TTC CAG GTC

C.2.2. Chu trình nhân gen

Bước

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Thời gian

Nhiệt đô

Bước 1

1 chu kỳ

45 min

37 °C

Bước 2

1 chu kỳ

10 min

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Bước 3

1 chu kỳ

5 min

94 °C

30 chu kỳ

1 min

94 °C

1 min

55 °C

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

72 °C

Bước 4

1 chu kỳ

8 min

72 °C

Bước 5

1 chu kỳ

4 °C

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Chuẩn bị thạch Agaroza 2 % pha trong dung dịch TAE 1X hoặc TBE 1X có Etidi bromua (10 μg/μl).

- Đổ thạch vào khuôn điện di (có lược).

- Thạch khô, rút lược ra và cho mẫu vào các giếng (8 μl sản phẩm PCR + 2 μl dung dịch loading dung dịch đệm).

- Sử dụng Marker trọng lượng phân tử (thang 100 bp).

- Chú ý khi chạy PCR phải có mẫu đối chứng dương và đối chứng âm đi kèm (mẫu đối chứng âm có thể là nước cất sạch).

C.2.4. Đọc kết quả

- Mẫu dương tính: Xuất hiện vạch và có kích thước bằng kích thước giống mẫu đối chứng dương

- Mẫu âm tính: Không có vạch.

C.2.5. Đánh giá kết quả

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

C.3. Phương pháp Realtime RT-PCR: sử dụng mồi và probe

C.3.1. Công thức

Áp dụng cho kit RT-PCR 1 bước của hãng Qiagen (nếu dùng kit khác có thể phải thay đổi công thức pha chế).

Nguyên liệu

Thể tích (ml)

H2O

10,5

Dung dịch đệm 5X

5,0

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

1,2

dNTP

0,8

Hỗn hợp enzym

1,0

Mồi xuôi (20 mM)

0,5

Mồi ngược (20 mM)

0,5

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

0,5

Mu ARN

5,0

Tổng cộng

25,0

 

Mồi và probe

Chuỗi (5 – 3)-FAM

Mồi xuôi

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Mồi ngược

TTGTACCAGGGYTTGGCYT

Probe

AAACACGGACCCGACTTTAACCG

C.3.2. Chu trình nhân gen

Bước

Chu kỳ

Thời gian

Nhiệt độ

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

1 chu kỳ

15 min

50 °C

2 min

95 °C

Bước biến tính

40 chu kỳ

10 s

95 °C

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

50 s

60 °C

C.3.3. Đọc kết quả

- Mẫu dương tính: Khi 35 ≥Ct≥20.

- Mẫu âm tính: Khi không có Ct.

- Mẫu nghi ngờ: Khi 40≥Ct≥35.

C.3.4. Đánh giá kết quả

Có virus lở mồm long móng ở trong mẫu bệnh phẩm nếu kết quả đồ thị Realtime RT- PCR dương tính. Với những mẫu nghi ngờ cần làm lại.

C.4. Định typ virus lở mồm long móng: sử dụng mồi typ O, A, Asia1 của Pirbright

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Áp dụng cho kit RT-PCR 1 bước của hãng Qiagen (nếu dùng kit khác có thể phải thay đổi công thức pha chế)

Nguyên liệu

Thể tích (ml)

H2O

12,0

5X Dung dịch đệm

5,0

dNTP

1,0

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

1,0

Mồi xuôi

0,5

Mồi ngược

0,5

Mẫu ARN

5,0

Tổng cộng

25,0

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Bước

Chu kỳ

Thời gian

Nhiệt độ

Bước 1

1 chu kỳ

45 min

37 °C

Bước 2

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

10 min

94 °C

Bước 3

1 chu kỳ

5 min

94 °C

 

20 chu kỳ

1 min

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

1 min

58 °C

2 min

72 °C

Bước 4

1 chu kỳ

8 min

72 °C

Bước 5

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

4 °C

Quy trình nhân gen này áp dụng cho mồi typ O, A, Asia1 của Pirbright, đối với các cặp mồi khác quy trình có thể thay đổi cho phù hợp.

Typ Virus

Cặp mồi

Chiều

Chuỗi (5 – 3)

Kích thước

(bp)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

P33

Ngược

AGC TTG TAC CAG GGT TTG GC

402

P38

Xuôi

GCT GCC TAC CTC CTT CAA

FMDV A

P33

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

AGC TTG TAC CAG GGT TTG GC

732

P87

Xuôi

GTC ATT GAC CTC ATG CAG ACC CAC

FMDV C

P33

Ngược

AGC TTG TAC CAG GGT TTG GC

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

P40

Xuôi

GTT TCT GCA CTT GAC AAC ACA

FMDV Asia 1

P33

Ngược

AGC TTG TAC CAG GGT TTG GC

292

P74

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

GAC ACC ACT CAG GAC CGC CG

C.4.3. Chạy điện di

- Chuẩn bị thạch Agaroza 2 % pha trong dung dịch TAE 1X hoặc TBE 1X có Etidi bromua (10 mg/ml).

- Đổ thạch vào khuôn điện di (có lược).

- Thạch khô, rút lược ra và cho mẫu vào các giếng (8ml sản phẩm PCR + ml dung dịch loading dung dịch đệm).

- Sử dụng Marker trọng lượng phân tử (thang 100 bp).

- Chú ý khi chạy PCR phải có mẫu đối chứng dương và đối chứng âm đi kèm (mẫu đối chứng âm có thể là nước cất sạch).

C.4.4. Đọc kết quả

- Mẫu dương tính: Xuất hiện vạch và có kích thước bằng kích thước giống mẫu đối chứng dương

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

C.4.5. Đánh giá kết quả

Virus lở mồm long móng ở trong mẫu bệnh phẩm thuộc typ gì tùy thuộc kết quả chạy điện di dương tính ở loại mồi nào.

 

Phụ lục D

(Quy định)

Quy trình kỹ thuật ELISA phát hiện kháng thể của PIRBRIGHT

D.1. Cách tiến hành

Gắn đĩa (coating): Kháng huyết thanh thỏ kháng virus lở mồm long móng đã pha loãng 1:1000 với coating dung dịch đệm, nhỏ 50 ml/giếng. Đậy nắp, ủ và lắc ở nhiệt độ 37 °C/1 h hoặc ủ qua đêm ở 4 °C.

Chuẩn bị hỗn hợp kháng nguyên-huyết thanh (liquid phase blocking), nhỏ vào đĩa nhựa polypropylen 96 giếng đáy chữ U (Phụ lục A):

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Kháng nguyên pha loãng theo tỷ lệ cho trước, 50 ml/giếng.

Hỗn hợp được ủ qua đêm ở 4 °C.

Rửa đĩa ELISA 3 lần bằng dung dịch rửa PBS 0,002 M (Phụ lục A)

Chuyển 50 ml hỗn hợp kháng nguyên-huyết thanh từ đĩa chữ U sang đĩa ELISA theo vị trí tương ứng (Phụ lục D). Đậy nắp, ủ và lắc ở nhiệt độ 37°C/1 h.

Rửa 3 lần bằng dung dịch rửa PBS 0,002M (Phụ lục A)

Nhỏ kháng thể phát hiện: Kháng huyết thanh chuột lang kháng virus lở mồm long móng pha loãng 1:100 với dung dịch đệm B, 50 ml/giếng. Đậy nắp, ủ và lắc ở nhiệt độ 37 °C/1 h.

Rửa 3 lần bằng dung dịch rửa PBS 0,002 M (Phụ lục A)

Nhỏ chất gắn kết: pha loãng 1:200 với dung dịch đệm B, 50 ml/giếng. Đậy nắp, ủ và lắc ở nhiệt độ 37 °C/40 min.

Rửa 3 lần bằng dung dịch rửa PBS 0,002 M (Phụ lục A)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Dừng phản ứng: nhỏ 50 ml/giếng bằng dung dịch H2SO4 1,25 M.

D.2. Đọc kết quả

Sử dụng máy đọc ELISA, kính lọc 492 nm. Sử dụng phần mềm edi để tính PI (phần trăm ức chế). Nếu PI ≥ 50 thì mẫu được coi là dương tính, trong huyết thanh có kháng thể lở mồm long móng.

Sơ đồ đĩa ELISA phát hiện kháng thể được trình bày ở Phụ lục D.

CHÚ Ý: Xác định hiệu giá kháng thể, mẫu huyết thanh được pha như sau:

- Huyết thanh kiểm tra: Pha loãng theo tỷ lệ 1:8.

- Nhỏ dung dịch dung dịch đệm A: 50 ml/giếng vào các lỗ của đĩa chữ U bắt đầu từ cột 3 cho đến cột thứ 12 của tất cả các hàng.

- Nhỏ huyết thanh kiểm tra đã pha loãng 1:8 vào các lỗ tương ứng 50 ml/giếng và pha loãng theo cơ số 2 từ hàng A đến hàng D và từ hàng E đến hàng H.

- Huyết thanh đối chứng: Chuẩn bị giống phát hiện kháng thể

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Hỗn hợp kháng nguyên-huyết thanh được ủ qua đêm ở 4 °C.

- Các bước sau tiến hành theo trình tự giống phản ứng ELISA phát hiện kháng thể.

Sơ đồ đĩa phản ứng ELISA

Sơ đồ đĩa phản ứng ELISA phát hiện kháng thể

Sơ đồ đĩa phn ứng ELISA định lượng kháng thể

CHÚ THÍCH C++: huyết thanh ĐC dương tính mạnh

                     C+: huyết thanh ĐC dương tính yếu

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

                     Ca: đối chứng kháng nguyên

Công thức tính PI: PI = 100 -

 

THƯ MỤC TÀI LIỆU THAM KHẢO

[1] Bộ Nông nghiệp và Phát triển nông thôn - Cục Thú y, 2006. Tiêu chuẩn, quy trình ngành thú y, Quy trình chẩn đoán bệnh Dịch tả lợn /10 TCN 717-2006, trang 270-282

[2] O.I.E., 2009. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, Foot and Mouth Disease, chapter 2.1.5

[3] Bộ Nông nghiệp và Phát triển nông thôn - Viện Thú y, 2002. Cẩm nang chẩn đoán tiêu chuẩn về các bệnh gia súc ở Việt Nam, in lần thứ nhất, bệnh Lở mồm Long móng, trang 32-33.

Văn bản này chưa cập nhật nội dung Tiếng Anh

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Tiêu chuẩn quốc gia TCVN 8400-1:2010 về Bệnh động vật - Quy trình chẩn đoán - Phần 1: Bệnh lở mồm long móng

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


4.781

DMCA.com Protection Status
IP: 18.232.56.9