Từ khoá: Số Hiệu, Tiêu đề hoặc Nội dung ngắn gọn của Văn Bản...

Đăng nhập

Quên mật khẩu?   Đăng ký mới
Đăng nhập bằng Google

Số hiệu: TCVN5273:2010 Loại văn bản: Tiêu chuẩn Việt Nam
Nơi ban hành: *** Người ký: ***
Ngày ban hành: Năm 2010 Ngày hiệu lực:
ICS:11.220 Tình trạng: Đã biết

Các tiêu bản

Kết quả huỳnh quang

Kết luận

Bệnh phẩm

Có virus dịch tả lợn

Bệnh phẩm

Không

Không có virus dịch tả lợn

5.2.4. Phương pháp miễn dịch huỳnh quang gián tiếp

5.2.4.1. Chuẩn bị mẫu, xem 5.2.3.1.

5.2.4.2. Cố định tiêu bản, xem 5.2.3.3.

5.2.4.3. Gắn kháng huyết thanh dịch tả lợn lên tiêu bản

Nhỏ từ 0,1 ml đến 0,2 ml kháng thể dịch tả lợn lên mỗi tiêu bản đặt trong khay ấm để nhiệt độ 37 °C trong 30 min (tiêu bản luôn luôn ướt trong suốt quá trình ủ).

Đổ bỏ huyết thanh, dùng bình có vòi bơm nhẹ dung dịch đệm (PBS) lên phiến kính tiêu bản trong cốc dung dịch đệm 10 min, thay PBS nhiều lần và liên tục lắc nhẹ phiến kính.

Lấy ra để tiêu bản khô, nhỏ chất gắn kết globulin thỏ kháng lợn lên các tiêu bản, đặt vào khay m 37 °C trong 30 min.

Sau đó thực hiện các bước như 5.2.3.4.

5.2.4.4. Đọc kết quả

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Tiêu bản tổ chức khỏe gắn chất gắn kết: kết quả (-)

- Tiêu bn bệnh phẩm cần kiểm tra nhỏ globulin miễn dịch không gắn FITC sau đó nhỏ tiếp chất gắn kết: kết quả đọc huỳnh quang giảm nhiều

- Đọc kết quả theo Bảng 1.

5.2.5. Phương pháp tiêm truyền qua th

5.2.5.1. Chuẩn bị mẫu

Chọn 6 thỏ mạnh khỏe từ 1,8 kg/con đến 2 kg/con. Chia thỏ làm 2 lô:

- Lô 1: tiêm dịch huyết phù bệnh phẩm nghi dịch tả lợn (máu của lợn bệnh đã khử fibrin hoặc hạch lách lợn bệnh pha loãng 10-1 đã xử lý kháng sinh) 1 ml vào tĩnh mạch tai 3 thỏ. Theo dõi nhiệt độ ngày 2 lần trong 7 ngày (thỏ phải không sốt).

- Lô 2: sau 7 ngày lấy thêm 3 thỏ mạnh khỏe lô 2 cùng với 3 thỏ lô 1 được tiêm thử thách bằng vắc xin nhược độc dịch tả lợn chủng C pha loãng 10-1, 1 ml vào tĩnh mạch tai.

5.2.5.2. Đọc kết quả

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Lô 1: nếu có sốt, bệnh phẩm âm tính; nếu không sốt, bệnh phẩm dương tính (+)

5.2.6. Phát hiện kháng thể

Phát hiện kháng thể dịch tả lợn có ý nghĩa chẩn đoán đối với lợn ốm có triệu chứng của bệnh dịch lợn và chưa bao giờ tiêm phòng, hoặc nhiễm virus dịch tả lợn từ trước.

Phương pháp ELISA phát hiện kháng thể: khi sử dụng kitELISA phát hiện kháng thể, thực hiện theo hướng dẫn của nhà sản xuất.

Phương pháp trung hòa trên tế bào (NPLA - Neutralising Peroxidase - Linked Assay). Ngoài việc sử dụng với mục đích chn đoán bệnh, phương pháp phát hiện kháng thể bằng phương pháp trung hòa trên tế bào còn có ý nghĩa đánh giá hiệu giá kháng thể khi tiêm phòng vắc xin dịch tả lợn.

Phương pháp này để xác định hàm lượng kháng thể có trong huyết thanh nhờ sự ức chế của kháng thể đối với virus dịch tả lợn được gây nhiễm trên tế bào.

Các bước tiến hành: xem Phụ lục C.

7. Kết luận

Lợn được xác định mắc bệnh dịch tả lợn khi có các đặc điểm dịch tễ học, triệu chứng lâm sàng của bệnh dịch tả lợn và kết quả dương tính với một trong những phương pháp xét nghiệm sau:

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

- Phản ứng rRT-PCR phát hiện virus dương tính.

- Phân lập được virus trên môi trường tế bào, và giám định virus dịch tả lợn dương tính.

- Phản ứng miễn dịch huỳnh quang trực tiếp dương tính

- Phản ứng miễn dịch huỳnh quang gián tiếp

- Phản ứng tiêm truyền qua thỏ dương tính

- Phản ứng ELISA phát hiện kháng thể dương tính gia súc chưa tiêm phòng.

- Phn ứng trung hòa kháng thể trên tế bào dương tính (ch áp dụng đối với lợn chưa tiêm phòng trong trường hợp chẩn đoán).

 

PHỤ LỤC A

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Chuẩn bị dung dịch để chẩn đoán bệnh dịch tả lợn

A.1. Dung dịch Glutamin/kháng sinh đậm đặc 100 lần (100x)

- Dung dịch A:               Glutamin                       2,92 g

Nước ct hai lần            50 ml

Hòa tan các thành phần trên rồi lọc qua lưới lọc cỡ lỗ 0,45 mm.

- Dung dịch B:   Penicillin                       1.000.000 U

Steptomycin                 1g

Mycostatin                    500.000 U

Polymixin                      150.000 U

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Nước cất hai lần            10 ml.

Hòa tan các thành phần trên bằng cách lắc đều.

- Dung dịch C: Hòa tan 50 ml dung dịch A, 10 ml dung dịch B và 40 ml nước cất hai lần và bảo quản âm 20 °C.

A.2. Dung dịch muối đệm Hank's (BSS) hoặc môi trường Hank’s MEM

Pha theo ch dẫn của hãng sản xuất. Hấp vô trùng. Bảo quản 4 °C.

A.3. Môi trường Eagle’s MEM

Môi trường Eagle’s MEM                                   9,4 g

Canh thang TPB (Tryptose Phosphat Broth)         2,95 g

Nước cất hai lần                                                1000 ml.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

A.4. Pha dung dịch Trypsin 5 % (10x)

Trypsin 1:250                5g

Nước cất hai lần            100 ml.

Khuấy bằng que khuấy từ, để qua đêm 4 °C. Lọc qua màng lọc c lỗ 0,45 mm. Bảo quản âm 20 °C.

A.5. Dung dịch muối đệm phosphat (PBS) pH 7,2

NaCl                                         8,5 g

Na2HPO4                                   1,07 g

NaH2PO4                                   0,39 g

Nước cất hai lần                        1 000 ml

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

A.6. Dung dịch đệm glyxerin pH = 8,3

Natri dihydrocacbonat (NaHCO3)            0,0715 g

Dinatri cacbonat (Na2CO3)                      0,00160g

Nước cất vô trùng                                 10 ml

Glyxerin vừa đủ                                     100 ml

Hòa tan các thành phần trên. Bảo quản nhiệt độ 4 °C, dùng khi đọc huỳnh quang.

A.7. Dung dịch kháng khuẩn

Penixillin bột

Streptomyxin

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Nước cất vô trùng

Hòa tan các thành phần trên. Bảo qun nhiệt độ 4 °C hoặc -20 °C.

 

PHỤ LỤC B

(Quy định)

Quy trình phản ứng rRT-PCR

B.1. Cách tiến hành

Pha master mix (hỗn hợp phản ứng)

Qiagen RT-PCR kit

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Nguyên liệu

Lượng

ml

Nguyên liệu

Lượng

ml

DW

10,5

DW

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Hỗn hợp đệm phản ứng 5x

5,0

Dung dịch đệm phản ứng 2x

1,5

MgCI2 (25 mM)

1,2

PPP

1,5

dNTP

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Hỗn hợp enzym

0,5

PPP

1,5

 

 

Hỗn hợp enzym

1,0

 

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

 

20,0

 

20,0

Cho 20 ul master mix và cho 5 ul mẫu ARN vào ống PCR (hoặc ống Smart);

Ly tâm nhanh;

Đặt ống PCR (hoặc ống Smart) vào máy real-time PCR;

Chọn chương trình chạy;

Chọn màu đọc (tùy theo probe);

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Chạy phản ứng:

Qiagen one-step RT-PCR Kit

Invitrogen SS3 qRT-PCR Kit

RT

PCR

RT

PCR

50 °C-30 min, 95 °C-15 min

40 x (95 °C-10s + 60 °C-50s)

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

40 x (95 °C-10 s + 6 0°C-50 s)

B.2. Đọc kết quả

- Mu được coi là dương tính khi có Ct £ 35.

- Mu được coi là âm tính nếu không có Ct.

- Mẫu được coi là nghi ngờ nếu Ct > 35.

Danh mục và trình tự mồi và probe dùng cho phương pháp RRT/PCR

Mồi/ Probe

Trình tự nucleotide (5'-3')

Modification

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

3'

Probe

TGATGG GGGTAC GAC CTGATA GGG T

HEX

BHQ1

Mồi xuôi

ATGCCCWTAGTAGGACTAGCA

None

None

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

TCAACTCCATGTGCCATGTAC

None

None

 

PHỤ LỤC C

(Quy định)

Phản ứng trung hòa kháng thể dịch tả lợn trên môi trường tế bào

C.1. Chuẩn bị

Pha loãng huyết thanh cần chn đoán với môi trường MEM có cha 5 % huyết thanh thai bê (không có kháng thể bệnh dịch tả lợn vì kháng thể này có thể trung hòa với virus dịch tả lợn).

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Cho tế bào PK15 hoặc CPK hoặc SK6 vào tất cả các giếng.

đĩa 2 ngày đến 3 ngày 37 °C. Kháng nguyên virus được phát hiện bằng phương pháp nhuộm miễn dịch.

Chun bị nguyên liệu:

- Kháng thể 1: Pig polyclonal antibody pha loãng 1/200 trong dung dịch PBS pH = 7,2.

- Kháng thể 2: Anti-pig IgG peroxidase conjugate (DAKO P0164) pha loãng 1/600 trong dung dịch PBS pH = 7,2 .(nếu sử dụng chất gắn kết khác cần chuẩn độ lại).

C.2. Tiến hành phản ứng

C.2.1. Chuẩn bị virus cho phản ứng NPLA

Chuẩn bị tế bào PK15 hoặc CPK hoặc SK6 vào chai nuôi cấy với lượng 5 x 104 tế bào/ml trong 15 ml môi trường (EMEM 5 % FCS). đĩa 37 °C/CO2 trong 24 h.

Nhiễm virus (100TCID50) vào chai.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Lưu giữ trong tủ -80 °C.

Làm rã đông và thu lấy môi trường vào ống 15 ml.

Ly tâm 3000 g trong vòng 20 min 4 °C.

Thu ly môi trường bên trên vào ống 50 ml.

Chia vào các ống nhỏ (200 ml/týp). Lưu giữ -80 °C.

Chuẩn độ virus trong đĩa 96 giếng.

Chun độ kháng th dịch t lợn bằng phản ứng NPLA.

Dùng đĩa 96 giếng.

Nhỏ 100 ml môi trường vào hàng đầu tiên của đĩa.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

CHÚ Ý: Bớt lại một hàng để chun độ ngược virus và làm đối chứng tế bào.

Pha loãng huyết thanh: Cho 10 ml huyết thanh vào hàng đầu tiên. Trộn đều và chuyển 50 ml sang hàng bên cạnh.

Nhỏ dung dịch virus 50 ml/giếng vào tất cả các giếng (trừ hàng cuối cùng).

Nhỏ 100 ml đối chứng virus pha loãng 1,1/10, 1/100, 1/1000, 1/10000.

Lắc đĩa.

đĩa 37 °C có 4 đến 5 % CO2 trong 24 h.

Nhỏ 100 ml tế bào PK15 hoặc CPK hoặc SK6 vào tất cả các giếng.

đĩa ở 37 °C có 4 % đến 5 % CO2 trong 2 ngày đến 3 ngày.

Nhuộm NPLA

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

Rửa đĩa 3 lần bằng PBS 1 % tween 80.

Cho 50 ml kháng thể 1 vào mỗi giếng, để tủ ấm 37 °C trong 30 min.

Rửa đĩa 3 lần bằng PBS 1 % tween 80.

Cho 50 ml kháng thể 2 vào mỗi giếng, để tủ ấm 37 °C trong 30 min.

Cho 50 ml cơ chất ACE vào mỗi giếng, để tủ ấm 37 °C từ 10 đến 20 min.

CHÚ THÍCH: Cơ cht phải sử dụng ngay sau khi pha.

C.3. Đọc kết quả

- Quan sát đĩa bằng kính hiển vi soi ngược.

- Nguyên sinh chất của tế bào bắt phn đỏ đậm (màu của ACE), kết luận không có kháng thể.

...

...

...

Bạn phải đăng nhập hoặc đăng ký Thành Viên TVPL Pro để sử dụng được đầy đủ các tiện ích gia tăng liên quan đến nội dung TCVN.

Mọi chi tiết xin liên hệ: ĐT: (028) 3930 3279 DĐ: 0906 22 99 66

 

THƯ MỤC TÀI LIỆU THAM KHẢO

[1] TCVN 5273:1990 Bệnh dịch tả lợn.

[2] 10 TCN 716-2006 Qui trình chẩn đoán bệnh Dịch tả lợn. Bộ Nông nghiệp và Phát triển nông thôn - Cục Thú y 2006.

[3] O.I.E., 2009. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, Classical swine fever, chapter 2.8.3

[4] Cẩm nang chẩn đoán tiêu chuẩn về các bệnh gia súc Việt Nam, in lần thứ nhất, Bệnh dịch tả lợn, trang 104-105. Bộ Nông nghiệp và Phát triển nông thôn - Viện Thú y, 2002.

Văn bản này chưa cập nhật nội dung Tiếng Anh

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


Tiêu chuẩn quốc gia TCVN 5273:2010 về Bệnh động vật - Quy trình chẩn đoán bệnh dịch tả lợn

Bạn Chưa Đăng Nhập Thành Viên!


Vì chưa Đăng Nhập nên Bạn chỉ xem được Thuộc tính của văn bản.
Bạn chưa xem được Hiệu lực của Văn bản, Văn bản liên quan, Văn bản thay thế, Văn bản gốc, Văn bản tiếng Anh,...


Nếu chưa là Thành Viên, mời Bạn Đăng ký Thành viên tại đây


4.867

DMCA.com Protection Status
IP: 222.255.214.198